EMAIL THIS PAGE TO A FRIEND

PIP5KL1

phosphatidylinositol-4-phosphate 5-kinase-like 1

Synonyms: PIPKH bA203J24.5
UniProtKB ID: Q5T9C9, Q8IVS3
Gene ID:
Human(138429) Summary: PIP5KL1 is a phosphoinositide kinase-like protein that lacks intrinsic lipid kinase activity but associates with type I PIPKs (see PIP5K1A; MIM 603275) and may play a role in localization of PIPK activity (Chang et al., 2004 [PubMed 14701839]
Mouse(227733) phosphatidylinositol-4-phosphate 5-kinase-like 1
Rat(687758) phosphatidylinositol-4-phosphate 5-kinase-like 1
Horse(100070364) phosphatidylinositol-4-phosphate 5-kinase-like 1
domestic cat(101094710) phosphatidylinositol-4-phosphate 5-kinase-like 1
dog(609122) phosphatidylinositol-4-phosphate 5-kinase-like 1
naked mole-rat(101716607) phosphatidylinositol-4-phosphate 5-kinase-like 1
Domestic Rabbit(100354393) phosphatidylinositol-4-phosphate 5-kinase-like 1
domestic guinea pig(100724020) phosphatidylinositol-4-phosphate 5-kinase-like 1
cow(523736) phosphatidylinositol-4-phosphate 5-kinase-like 1
sheep(101109528) phosphatidylinositol-4-phosphate 5-kinase-like 1
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173492 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120201 MISSION® esiRNA esiRNA human PIP5KL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173492 Rosetta Predictions human pricing
XM_001080030 Rosetta Predictions rat pricing
NM_198191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102365 predicted 439
2 SASI_Hs01_00102366 predicted 236
3 SASI_Hs01_00102367 predicted 449
4 SASI_Hs01_00102368 predicted 248
5 SASI_Hs01_00102369 predicted 647
6 SASI_Hs01_00102370 predicted 622
7 SASI_Hs01_00102371 predicted 232
8 SASI_Hs01_00102372 predicted 445
9 SASI_Hs01_00102374 predicted 375
10 SASI_Hs02_00368257 predicted 536
11 SASI_Hs01_00102373 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366298 predicted 1749
2 SASI_Rn02_00366299 predicted 208
3 SASI_Rn02_00366300 predicted 1487
4 SASI_Rn02_00366301 predicted 1877
5 SASI_Rn02_00366302 predicted 1656
6 SASI_Rn02_00366303 predicted 984
7 SASI_Rn02_00366304 predicted 1882
8 SASI_Rn02_00366305 predicted 801
9 SASI_Rn02_00366306 predicted 1087
10 SASI_Rn02_00366307 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067254 predicted 310
2 SASI_Mm01_00067255 predicted 972
3 SASI_Mm01_00067256 predicted 1133
4 SASI_Mm01_00067257 predicted 462
5 SASI_Mm01_00067258 predicted 1010
6 SASI_Mm01_00067259 predicted 903
7 SASI_Mm01_00067260 predicted 1257
8 SASI_Mm01_00067261 predicted 237
9 SASI_Mm01_00067262 predicted 758
10 SASI_Mm01_00067263 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198191
PIP5KL1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 5-kinase-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198191.2-774s21c1
Sequence:CCGGTGCTGAAGGACCTCAACTTTCCTCGAGGAAAGTTGAGGTCCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198191.2-675s21c1
Sequence:CCGGTCTACCCTACCAGCCGCATTTCTCGAGAAATGCGGCTGGTAGGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198191.2-1089s21c1
Sequence:CCGGTGGATATGACTACCGTGTATGCTCGAGCATACACGGTAGTCATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198191.2-708s21c1
Sequence:CCGGACATCAAGGGCTGCAACATAACTCGAGTTATGTTGCAGCCCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-742s1c1
Sequence:CCGGGTATGACATCAAGGGCTGCAACTCGAGTTGCAGCCCTTGATGTCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-474s1c1
Sequence:CCGGCCTACCTTCAATTCTTCAGCACTCGAGTGCTGAAGAATTGAAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-241s1c1
Sequence:CCGGGCTGCATAGAATGACACGAATCTCGAGATTCGTGTCATTCTATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-1172s1c1
Sequence:CCGGGTGTGGAAGATGGTACGCTATCTCGAGATAGCGTACCATCTTCCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-995s1c1
Sequence:CCGGAGCACATTCAAGTCCATACAACTCGAGTTGTATGGACTTGAATGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198191
PIP5KL1 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 5-kinase-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198191.2-774s21c1
Sequence:CCGGTGCTGAAGGACCTCAACTTTCCTCGAGGAAAGTTGAGGTCCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198191.2-675s21c1
Sequence:CCGGTCTACCCTACCAGCCGCATTTCTCGAGAAATGCGGCTGGTAGGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198191.2-1089s21c1
Sequence:CCGGTGGATATGACTACCGTGTATGCTCGAGCATACACGGTAGTCATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198191.2-708s21c1
Sequence:CCGGACATCAAGGGCTGCAACATAACTCGAGTTATGTTGCAGCCCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-742s1c1
Sequence:CCGGGTATGACATCAAGGGCTGCAACTCGAGTTGCAGCCCTTGATGTCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-474s1c1
Sequence:CCGGCCTACCTTCAATTCTTCAGCACTCGAGTGCTGAAGAATTGAAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-241s1c1
Sequence:CCGGGCTGCATAGAATGACACGAATCTCGAGATTCGTGTCATTCTATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-1172s1c1
Sequence:CCGGGTGTGGAAGATGGTACGCTATCTCGAGATAGCGTACCATCTTCCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-995s1c1
Sequence:CCGGAGCACATTCAAGTCCATACAACTCGAGTTGTATGGACTTGAATGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198191
PIP5KL1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 5-kinase-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198191.2-774s21c1
Sequence:CCGGTGCTGAAGGACCTCAACTTTCCTCGAGGAAAGTTGAGGTCCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198191.2-675s21c1
Sequence:CCGGTCTACCCTACCAGCCGCATTTCTCGAGAAATGCGGCTGGTAGGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198191.2-1089s21c1
Sequence:CCGGTGGATATGACTACCGTGTATGCTCGAGCATACACGGTAGTCATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198191.2-708s21c1
Sequence:CCGGACATCAAGGGCTGCAACATAACTCGAGTTATGTTGCAGCCCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-742s1c1
Sequence:CCGGGTATGACATCAAGGGCTGCAACTCGAGTTGCAGCCCTTGATGTCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-474s1c1
Sequence:CCGGCCTACCTTCAATTCTTCAGCACTCGAGTGCTGAAGAATTGAAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-241s1c1
Sequence:CCGGGCTGCATAGAATGACACGAATCTCGAGATTCGTGTCATTCTATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-1172s1c1
Sequence:CCGGGTGTGGAAGATGGTACGCTATCTCGAGATAGCGTACCATCTTCCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198191.1-995s1c1
Sequence:CCGGAGCACATTCAAGTCCATACAACTCGAGTTGTATGGACTTGAATGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173492
VALIDATED
PIP5KL1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 5-kinase-like 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-323s21c1
Sequence:CCGGTGCTGAAGGACCTCAACTTTCCTCGAGGAAAGTTGAGGTCCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173492.1-245s21c1
Sequence:CCGGCCGAGAGGTATGACATCAAAGCTCGAGCTTTGATGTCATACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-976s21c1
Sequence:CCGGCCCTACTTTAGCTCATTTAATCTCGAGATTAAATGAGCTAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173492.1-434s21c1
Sequence:CCGGTGGATTACAGCCTCCTGATAGCTCGAGCTATCAGGAGGCTGTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173492.1-394s21c1
Sequence:CCGGATGGAACTGGATACCACCTTCCTCGAGGAAGGTGGTATCCAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-912s21c1
Sequence:CCGGTAATACCGTAACCGCGCAGTCCTCGAGGACTGCGCGGTTACGGTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-802s21c1
Sequence:CCGGACTCTCCGGATCTGGACGATGCTCGAGCATCGTCCAGATCCGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-679s21c1
Sequence:CCGGGAGCACCTGTGGAAGACACTGCTCGAGCAGTGTCTTCCACAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173492.1-457s21c1
Sequence:CCGGTTCCAACGTCTCCACGAGGATCTCGAGATCCTCGTGGAGACGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173492.1-244s1c1
Sequence:CCGGTCCGAGAGGTATGACATCAAACTCGAGTTTGATGTCATACCTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173492.1-976s1c1
Sequence:CCGGCCCTACTTTAGCTCATTTAATCTCGAGATTAAATGAGCTAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173492.1-322s1c1
Sequence:CCGGGTGCTGAAGGACCTCAACTTTCTCGAGAAAGTTGAGGTCCTTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173492.1-684s1c1
Sequence:CCGGCCTGTGGAAGACACTGCGCTACTCGAGTAGCGCAGTGTCTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173492.1-385s1c1
Sequence:CCGGCTCCGCCAGATGGAACTGGATCTCGAGATCCAGTTCCATCTGGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199721    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173492.1-927s1c1
Sequence:CCGGGCAGTCCCGTTTGACGGTGGTCTCGAGACCACCGTCAAACGGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199024    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173492.1-905s1c1
Sequence:CCGGCCCTAACTAATACCGTAACCGCTCGAGCGGTTACGGTATTAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173492
VALIDATED
PIP5KL1 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 5-kinase-like 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-323s21c1
Sequence:CCGGTGCTGAAGGACCTCAACTTTCCTCGAGGAAAGTTGAGGTCCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173492.1-245s21c1
Sequence:CCGGCCGAGAGGTATGACATCAAAGCTCGAGCTTTGATGTCATACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-976s21c1
Sequence:CCGGCCCTACTTTAGCTCATTTAATCTCGAGATTAAATGAGCTAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173492.1-434s21c1
Sequence:CCGGTGGATTACAGCCTCCTGATAGCTCGAGCTATCAGGAGGCTGTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173492.1-394s21c1
Sequence:CCGGATGGAACTGGATACCACCTTCCTCGAGGAAGGTGGTATCCAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-912s21c1
Sequence:CCGGTAATACCGTAACCGCGCAGTCCTCGAGGACTGCGCGGTTACGGTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-802s21c1
Sequence:CCGGACTCTCCGGATCTGGACGATGCTCGAGCATCGTCCAGATCCGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-679s21c1
Sequence:CCGGGAGCACCTGTGGAAGACACTGCTCGAGCAGTGTCTTCCACAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173492.1-457s21c1
Sequence:CCGGTTCCAACGTCTCCACGAGGATCTCGAGATCCTCGTGGAGACGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173492.1-244s1c1
Sequence:CCGGTCCGAGAGGTATGACATCAAACTCGAGTTTGATGTCATACCTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173492.1-976s1c1
Sequence:CCGGCCCTACTTTAGCTCATTTAATCTCGAGATTAAATGAGCTAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173492.1-322s1c1
Sequence:CCGGGTGCTGAAGGACCTCAACTTTCTCGAGAAAGTTGAGGTCCTTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173492.1-684s1c1
Sequence:CCGGCCTGTGGAAGACACTGCGCTACTCGAGTAGCGCAGTGTCTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173492.1-385s1c1
Sequence:CCGGCTCCGCCAGATGGAACTGGATCTCGAGATCCAGTTCCATCTGGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199721    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173492.1-927s1c1
Sequence:CCGGGCAGTCCCGTTTGACGGTGGTCTCGAGACCACCGTCAAACGGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199024    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173492.1-905s1c1
Sequence:CCGGCCCTAACTAATACCGTAACCGCTCGAGCGGTTACGGTATTAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173492
VALIDATED
PIP5KL1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 5-kinase-like 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-323s21c1
Sequence:CCGGTGCTGAAGGACCTCAACTTTCCTCGAGGAAAGTTGAGGTCCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173492.1-245s21c1
Sequence:CCGGCCGAGAGGTATGACATCAAAGCTCGAGCTTTGATGTCATACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-976s21c1
Sequence:CCGGCCCTACTTTAGCTCATTTAATCTCGAGATTAAATGAGCTAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173492.1-434s21c1
Sequence:CCGGTGGATTACAGCCTCCTGATAGCTCGAGCTATCAGGAGGCTGTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173492.1-394s21c1
Sequence:CCGGATGGAACTGGATACCACCTTCCTCGAGGAAGGTGGTATCCAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-912s21c1
Sequence:CCGGTAATACCGTAACCGCGCAGTCCTCGAGGACTGCGCGGTTACGGTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-802s21c1
Sequence:CCGGACTCTCCGGATCTGGACGATGCTCGAGCATCGTCCAGATCCGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173492.1-679s21c1
Sequence:CCGGGAGCACCTGTGGAAGACACTGCTCGAGCAGTGTCTTCCACAGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173492.1-457s21c1
Sequence:CCGGTTCCAACGTCTCCACGAGGATCTCGAGATCCTCGTGGAGACGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173492.1-244s1c1
Sequence:CCGGTCCGAGAGGTATGACATCAAACTCGAGTTTGATGTCATACCTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173492.1-976s1c1
Sequence:CCGGCCCTACTTTAGCTCATTTAATCTCGAGATTAAATGAGCTAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173492.1-322s1c1
Sequence:CCGGGTGCTGAAGGACCTCAACTTTCTCGAGAAAGTTGAGGTCCTTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173492.1-684s1c1
Sequence:CCGGCCTGTGGAAGACACTGCGCTACTCGAGTAGCGCAGTGTCTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173492.1-385s1c1
Sequence:CCGGCTCCGCCAGATGGAACTGGATCTCGAGATCCAGTTCCATCTGGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199721    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173492.1-927s1c1
Sequence:CCGGGCAGTCCCGTTTGACGGTGGTCTCGAGACCACCGTCAAACGGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199024    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173492.1-905s1c1
Sequence:CCGGCCCTAACTAATACCGTAACCGCTCGAGCGGTTACGGTATTAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks