EMAIL THIS PAGE TO A FRIEND

PITHD1

PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1

Synonyms: C1orf128 HT014 RP5-886K2.4 TXNL1CL
UniProtKB ID: Q9GZP4, B2R7J4, Q5QPN6, Q5QPN7, Q9NRI8
Gene ID:
Mouse(66193) PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
Rat(298557) PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
Zebrafish(404606) PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
dog(612304) PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
domestic cat(101096496) PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
chicken(419684) PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
cow(506494) PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
sheep(101120644) PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
domestic guinea pig(100713843) PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
naked mole-rat(101713946) PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020362 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020362 Rosetta Predictions human pricing
XM_001068778 Rosetta Predictions rat pricing
XM_216543 Rosetta Predictions rat pricing
NM_025411 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082538 predicted 363
2 SASI_Hs01_00082539 predicted 596
3 SASI_Hs01_00082540 predicted 596
4 SASI_Hs01_00082541 predicted 603
5 SASI_Hs01_00082542 predicted 599
6 SASI_Hs01_00082544 predicted 650
7 SASI_Hs01_00082545 predicted 363
8 SASI_Hs01_00082546 predicted 807
9 SASI_Hs01_00082547 predicted 380
10 SASI_Hs02_00353306 predicted 793
11 SASI_Hs01_00082543 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325810 predicted 368
2 SASI_Rn02_00325811 predicted 496
3 SASI_Rn02_00325812 predicted 787
4 SASI_Rn02_00325813 predicted 534
5 SASI_Rn02_00325814 predicted 354
6 SASI_Rn02_00325815 predicted 513
7 SASI_Rn02_00325816 predicted 837
8 SASI_Rn02_00325817 predicted 517
9 SASI_Rn02_00325818 predicted 361
10 SASI_Rn02_00325819 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376650 predicted 365
2 SASI_Rn02_00376651 predicted 499
3 SASI_Rn02_00376652 predicted 784
4 SASI_Rn02_00376653 predicted 531
5 SASI_Rn02_00376654 predicted 356
6 SASI_Rn02_00376655 predicted 512
7 SASI_Rn02_00376656 predicted 834
8 SASI_Rn02_00376657 predicted 513
9 SASI_Rn02_00376658 predicted 368
10 SASI_Rn02_00376659 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045562 predicted 1102
2 SASI_Mm01_00045564 predicted 503
3 SASI_Mm01_00045566 predicted 330
4 SASI_Mm01_00045567 predicted 1119
5 SASI_Mm02_00328179 predicted 957
6 SASI_Mm02_00328180 predicted 438
7 SASI_Mm01_00045569 predicted 441
8 SASI_Mm01_00045570 predicted 348
9 SASI_Mm01_00045571 predicted 365
10 SASI_Mm02_00328181 predicted 586
11 SASI_Mm01_00045563 predicted 1046
12 SASI_Mm01_00045565 predicted 962
13 SASI_Mm01_00045568 predicted 1250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025411
VALIDATED
PITHD1 MISSION shRNA Bacterial Glycerol Stock
PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025411.2-511s1c1
Sequence:CCGGCAGGAGAATTAGAATATGCTACTCGAGTAGCATATTCTAATTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025411.2-725s1c1
Sequence:CCGGCAGACACACTTCATTTCTTAACTCGAGTTAAGAAATGAAGTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025411.2-300s1c1
Sequence:CCGGCGCTCCAAGTTTGTTGAAAGTCTCGAGACTTTCAACAAACTTGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025411.2-724s1c1
Sequence:CCGGGCAGACACACTTCATTTCTTACTCGAGTAAGAAATGAAGTGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025411.2-335s1c1
Sequence:CCGGGCTCCTGTTTAATATTCCGTTCTCGAGAACGGAATATTAAACAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025411
VALIDATED
PITHD1 MISSION shRNA shRNA Plasmid DNA
PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025411.2-511s1c1
Sequence:CCGGCAGGAGAATTAGAATATGCTACTCGAGTAGCATATTCTAATTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025411.2-725s1c1
Sequence:CCGGCAGACACACTTCATTTCTTAACTCGAGTTAAGAAATGAAGTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025411.2-300s1c1
Sequence:CCGGCGCTCCAAGTTTGTTGAAAGTCTCGAGACTTTCAACAAACTTGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025411.2-724s1c1
Sequence:CCGGGCAGACACACTTCATTTCTTACTCGAGTAAGAAATGAAGTGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025411.2-335s1c1
Sequence:CCGGGCTCCTGTTTAATATTCCGTTCTCGAGAACGGAATATTAAACAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025411
VALIDATED
PITHD1 MISSION shRNA Lentiviral Transduction Particles
PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025411.2-511s1c1
Sequence:CCGGCAGGAGAATTAGAATATGCTACTCGAGTAGCATATTCTAATTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025411.2-725s1c1
Sequence:CCGGCAGACACACTTCATTTCTTAACTCGAGTTAAGAAATGAAGTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025411.2-300s1c1
Sequence:CCGGCGCTCCAAGTTTGTTGAAAGTCTCGAGACTTTCAACAAACTTGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025411.2-724s1c1
Sequence:CCGGGCAGACACACTTCATTTCTTACTCGAGTAAGAAATGAAGTGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025411.2-335s1c1
Sequence:CCGGGCTCCTGTTTAATATTCCGTTCTCGAGAACGGAATATTAAACAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020362
VALIDATED
PITHD1 MISSION shRNA Bacterial Glycerol Stock
PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020362.2-343s1c1
Sequence:CCGGGATGAAGAGCTTCTGTTTAATCTCGAGATTAAACAGAAGCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020362.2-566s1c1
Sequence:CCGGCAAATGTCTATCATCTCTCAACTCGAGTTGAGAGATGATAGACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020362.4-511s21c1
Sequence:CCGGTAGTCTGAACCGGGATCTTACCTCGAGGTAAGATCCCGGTTCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020362.4-1202s21c1
Sequence:CCGGTCAGGAGGGTCTCCAACTAAACTCGAGTTTAGTTGGAGACCCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020362.4-577s21c1
Sequence:CCGGCTATCATCTCTCAATTCATATCTCGAGATATGAATTGAGAGATGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020362.4-387s21c1
Sequence:CCGGTCAAGCTCAAAGGCATCATTACTCGAGTAATGATGCCTTTGAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020362.4-608s21c1
Sequence:CCGGTTCGGAGCAGATACGACAAAGCTCGAGCTTTGTCGTATCTGCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020362
VALIDATED
PITHD1 MISSION shRNA shRNA Plasmid DNA
PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020362.2-343s1c1
Sequence:CCGGGATGAAGAGCTTCTGTTTAATCTCGAGATTAAACAGAAGCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020362.2-566s1c1
Sequence:CCGGCAAATGTCTATCATCTCTCAACTCGAGTTGAGAGATGATAGACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020362.4-511s21c1
Sequence:CCGGTAGTCTGAACCGGGATCTTACCTCGAGGTAAGATCCCGGTTCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020362.4-1202s21c1
Sequence:CCGGTCAGGAGGGTCTCCAACTAAACTCGAGTTTAGTTGGAGACCCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020362.4-577s21c1
Sequence:CCGGCTATCATCTCTCAATTCATATCTCGAGATATGAATTGAGAGATGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020362.4-387s21c1
Sequence:CCGGTCAAGCTCAAAGGCATCATTACTCGAGTAATGATGCCTTTGAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020362.4-608s21c1
Sequence:CCGGTTCGGAGCAGATACGACAAAGCTCGAGCTTTGTCGTATCTGCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020362
VALIDATED
PITHD1 MISSION shRNA Lentiviral Transduction Particles
PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020362.2-343s1c1
Sequence:CCGGGATGAAGAGCTTCTGTTTAATCTCGAGATTAAACAGAAGCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020362.2-566s1c1
Sequence:CCGGCAAATGTCTATCATCTCTCAACTCGAGTTGAGAGATGATAGACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020362.4-511s21c1
Sequence:CCGGTAGTCTGAACCGGGATCTTACCTCGAGGTAAGATCCCGGTTCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020362.4-1202s21c1
Sequence:CCGGTCAGGAGGGTCTCCAACTAAACTCGAGTTTAGTTGGAGACCCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020362.4-577s21c1
Sequence:CCGGCTATCATCTCTCAATTCATATCTCGAGATATGAATTGAGAGATGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020362.4-387s21c1
Sequence:CCGGTCAAGCTCAAAGGCATCATTACTCGAGTAATGATGCCTTTGAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020362.4-608s21c1
Sequence:CCGGTTCGGAGCAGATACGACAAAGCTCGAGCTTTGTCGTATCTGCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks