EMAIL THIS PAGE TO A FRIEND

PITPNC1

phosphatidylinositol transfer protein, cytoplasmic 1

Synonyms: M-RDGB-beta MRDGBbeta RDGB-BETA RDGBB RDGBB1
UniProtKB ID: Q9UKF7, Q96I07
Gene ID:
Human(26207) Summary: This gene encodes a member of the phosphatidylinositol transfer protein family. The encoded cytoplasmic protein plays a role in multiple processes including cell signaling and lipid metabolism by facilitating the transfer of phosphatidylinositol between membrane compartments. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 1. [provided by RefSeq, May 2012]
Mouse(71795) phosphatidylinositol transfer protein, cytoplasmic 1
Rat(498015) phosphatidylinositol transfer protein, cytoplasmic 1
chicken(417424) phosphatidylinositol transfer protein, cytoplasmic 1
domestic cat(101100606) phosphatidylinositol transfer protein, cytoplasmic 1
Horse(100034047) phosphatidylinositol transfer protein, cytoplasmic 1
dog(610855) phosphatidylinositol transfer protein, cytoplasmic 1
cow(782067) phosphatidylinositol transfer protein, cytoplasmic 1
sheep(101103493) phosphatidylinositol transfer protein, cytoplasmic 1
naked mole-rat(101712977) phosphatidylinositol transfer protein, cytoplasmic 1
domestic guinea pig(100736186) phosphatidylinositol transfer protein, cytoplasmic 1
151 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012417 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113751 MISSION® esiRNA esiRNA human PITPNC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012417 Rosetta Predictions human pricing
NM_181671 Rosetta Predictions human pricing
XM_001081613 Rosetta Predictions rat pricing
XM_573213 Rosetta Predictions rat pricing
NM_145823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068466 predicted 1633
2 SASI_Hs01_00068468 predicted 1597
3 SASI_Hs02_00344277 predicted 1632
4 SASI_Hs01_00068470 predicted 742
5 SASI_Hs01_00068471 predicted 652
6 SASI_Hs01_00068472 predicted 599
7 SASI_Hs01_00068473 predicted 550
8 SASI_Hs01_00068474 predicted 756
9 SASI_Hs02_00344278 predicted 1761
10 SASI_Hs02_00344279 predicted 605
11 SASI_Hs01_00068465 predicted 800
12 SASI_Hs01_00068467 predicted 621
13 SASI_Hs01_00068469 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111581 predicted 741
2 SASI_Hs01_00111582 predicted 652
3 SASI_Hs01_00111583 predicted 602
4 SASI_Hs01_00111584 predicted 549
5 SASI_Hs01_00111585 predicted 753
6 SASI_Hs02_00370261 predicted 606
7 SASI_Hs01_00111580 predicted 669
8 SASI_Hs02_00370262 predicted 1021
9 SASI_Hs02_00370263 predicted 1122
10 SASI_Hs02_00370264 predicted 885
11 SASI_Hs01_00111578 predicted 800
12 SASI_Hs01_00111579 predicted 624
13 SASI_Hs01_00111586 predicted 594
14 SASI_Hs01_00111587 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372699 predicted 1594
2 SASI_Rn02_00372700 predicted 1721
3 SASI_Rn02_00372701 predicted 1412
4 SASI_Rn02_00372702 predicted 1165
5 SASI_Rn02_00372703 predicted 1191
6 SASI_Rn02_00372704 predicted 1282
7 SASI_Rn02_00372705 predicted 1172
8 SASI_Rn02_00372706 predicted 1333
9 SASI_Rn02_00372707 predicted 1591
10 SASI_Rn02_00372708 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400014 predicted 1720
2 SASI_Rn02_00400015 predicted 1657
3 SASI_Rn02_00400016 predicted 1765
4 SASI_Rn02_00400017 predicted 1711
5 SASI_Rn02_00400018 predicted 1683
6 SASI_Rn02_00400019 predicted 1669
7 SASI_Rn02_00400020 predicted 1759
8 SASI_Rn02_00400021 predicted 1646
9 SASI_Rn02_00400022 predicted 1754
10 SASI_Rn02_00400023 predicted 1707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083145 predicted 1302
2 SASI_Mm01_00083146 predicted 1631
3 SASI_Mm02_00341286 predicted 1081
4 SASI_Mm01_00083147 predicted 1329
5 SASI_Mm02_00341287 predicted 1443
6 SASI_Mm02_00341288 predicted 1105
7 SASI_Mm01_00083148 predicted 1187
8 SASI_Mm01_00083149 predicted 1046
9 SASI_Mm01_00083150 predicted 1245
10 SASI_Mm01_00083152 predicted 1473
11 SASI_Mm01_00083151 predicted 1194
12 SASI_Mm01_00083153 predicted 951
13 SASI_Mm01_00083154 predicted 1244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145823
VALIDATED
PITPNC1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol transfer protein, cytoplasmic 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1028s21c1
Sequence:CCGGGACCGAGAAGGCGTGGAATTACTCGAGTAATTCCACGCCTTCTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1505s21c1
Sequence:CCGGGCATGAACAAACCAACATAAACTCGAGTTTATGTTGGTTTGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1751s21c1
Sequence:CCGGGCGCCAGAATTTCTGTCCATTCTCGAGAATGGACAGAAATTCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1088s21c1
Sequence:CCGGGCCGAAATTCTCCATCCACATCTCGAGATGTGGATGGAGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1404s21c1
Sequence:CCGGGTCCGAGACATCTTGCTGATTCTCGAGAATCAGCAAGATGTCTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145823.1-1732s1c1
Sequence:CCGGGCGCCAGAATTTCTGTCCATTCTCGAGAATGGACAGAAATTCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145823.1-1070s1c1
Sequence:CCGGCCGAAATTCTCCATCCACATACTCGAGTATGTGGATGGAGAATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145823.1-824s1c1
Sequence:CCGGCAGCTGTATATGATCAGCAAACTCGAGTTTGCTGATCATATACAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145823.1-1385s1c1
Sequence:CCGGGTCCGAGACATCTTGCTGATTCTCGAGAATCAGCAAGATGTCTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145823.1-1069s1c1
Sequence:CCGGGCCGAAATTCTCCATCCACATCTCGAGATGTGGATGGAGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145823
VALIDATED
PITPNC1 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol transfer protein, cytoplasmic 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1028s21c1
Sequence:CCGGGACCGAGAAGGCGTGGAATTACTCGAGTAATTCCACGCCTTCTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1505s21c1
Sequence:CCGGGCATGAACAAACCAACATAAACTCGAGTTTATGTTGGTTTGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1751s21c1
Sequence:CCGGGCGCCAGAATTTCTGTCCATTCTCGAGAATGGACAGAAATTCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1088s21c1
Sequence:CCGGGCCGAAATTCTCCATCCACATCTCGAGATGTGGATGGAGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1404s21c1
Sequence:CCGGGTCCGAGACATCTTGCTGATTCTCGAGAATCAGCAAGATGTCTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145823.1-1732s1c1
Sequence:CCGGGCGCCAGAATTTCTGTCCATTCTCGAGAATGGACAGAAATTCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145823.1-1070s1c1
Sequence:CCGGCCGAAATTCTCCATCCACATACTCGAGTATGTGGATGGAGAATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145823.1-824s1c1
Sequence:CCGGCAGCTGTATATGATCAGCAAACTCGAGTTTGCTGATCATATACAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145823.1-1385s1c1
Sequence:CCGGGTCCGAGACATCTTGCTGATTCTCGAGAATCAGCAAGATGTCTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145823.1-1069s1c1
Sequence:CCGGGCCGAAATTCTCCATCCACATCTCGAGATGTGGATGGAGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145823
VALIDATED
PITPNC1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol transfer protein, cytoplasmic 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1028s21c1
Sequence:CCGGGACCGAGAAGGCGTGGAATTACTCGAGTAATTCCACGCCTTCTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1505s21c1
Sequence:CCGGGCATGAACAAACCAACATAAACTCGAGTTTATGTTGGTTTGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1751s21c1
Sequence:CCGGGCGCCAGAATTTCTGTCCATTCTCGAGAATGGACAGAAATTCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1088s21c1
Sequence:CCGGGCCGAAATTCTCCATCCACATCTCGAGATGTGGATGGAGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145823.2-1404s21c1
Sequence:CCGGGTCCGAGACATCTTGCTGATTCTCGAGAATCAGCAAGATGTCTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145823.1-1732s1c1
Sequence:CCGGGCGCCAGAATTTCTGTCCATTCTCGAGAATGGACAGAAATTCTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145823.1-1070s1c1
Sequence:CCGGCCGAAATTCTCCATCCACATACTCGAGTATGTGGATGGAGAATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145823.1-824s1c1
Sequence:CCGGCAGCTGTATATGATCAGCAAACTCGAGTTTGCTGATCATATACAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145823.1-1385s1c1
Sequence:CCGGGTCCGAGACATCTTGCTGATTCTCGAGAATCAGCAAGATGTCTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145823.1-1069s1c1
Sequence:CCGGGCCGAAATTCTCCATCCACATCTCGAGATGTGGATGGAGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012417
VALIDATED
PITPNC1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol transfer protein, cytoplasmic 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012417.2-761s21c1
Sequence:CCGGTGATATTGCCTGCGATGAAATCTCGAGATTTCATCGCAGGCAATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012417.2-1746s21c1
Sequence:CCGGATACTCTCAGGCATAACATACCTCGAGGTATGTTATGCCTGAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012417.2-961s21c1
Sequence:CCGGACAAGGTGGTCCGAGACATTCCTCGAGGAATGTCTCGGACCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012417.2-1318s21c1
Sequence:CCGGATAAGCCATGTCGGCCCAAATCTCGAGATTTGGGCCGACATGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012417.2-610s21c1
Sequence:CCGGACTATTATCCCTACACAATTACTCGAGTAATTGTGTAGGGATAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012417.2-653s1c1
Sequence:CCGGGCCGAAATTCTCCATTCATATCTCGAGATATGAATGGAGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012417.2-1202s1c1
Sequence:CCGGCGAATTTCTGTCCGTTCCCAACTCGAGTTGGGAACGGACAGAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012417.2-381s1c1
Sequence:CCGGCTCACCGTAGACGAGTACAAACTCGAGTTTGTACTCGTCTACGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012417.2-1036s1c1
Sequence:CCGGCAATGGATGAAGTCCGAGAATCTCGAGATTCTCGGACTTCATCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012417.2-528s1c1
Sequence:CCGGCGGGTGTATCTCAACAGCAAACTCGAGTTTGCTGTTGAGATACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012417
VALIDATED
PITPNC1 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol transfer protein, cytoplasmic 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012417.2-761s21c1
Sequence:CCGGTGATATTGCCTGCGATGAAATCTCGAGATTTCATCGCAGGCAATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012417.2-1746s21c1
Sequence:CCGGATACTCTCAGGCATAACATACCTCGAGGTATGTTATGCCTGAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012417.2-961s21c1
Sequence:CCGGACAAGGTGGTCCGAGACATTCCTCGAGGAATGTCTCGGACCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012417.2-1318s21c1
Sequence:CCGGATAAGCCATGTCGGCCCAAATCTCGAGATTTGGGCCGACATGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012417.2-610s21c1
Sequence:CCGGACTATTATCCCTACACAATTACTCGAGTAATTGTGTAGGGATAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012417.2-653s1c1
Sequence:CCGGGCCGAAATTCTCCATTCATATCTCGAGATATGAATGGAGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012417.2-1202s1c1
Sequence:CCGGCGAATTTCTGTCCGTTCCCAACTCGAGTTGGGAACGGACAGAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012417.2-381s1c1
Sequence:CCGGCTCACCGTAGACGAGTACAAACTCGAGTTTGTACTCGTCTACGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012417.2-1036s1c1
Sequence:CCGGCAATGGATGAAGTCCGAGAATCTCGAGATTCTCGGACTTCATCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012417.2-528s1c1
Sequence:CCGGCGGGTGTATCTCAACAGCAAACTCGAGTTTGCTGTTGAGATACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012417
VALIDATED
PITPNC1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol transfer protein, cytoplasmic 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012417.2-761s21c1
Sequence:CCGGTGATATTGCCTGCGATGAAATCTCGAGATTTCATCGCAGGCAATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012417.2-1746s21c1
Sequence:CCGGATACTCTCAGGCATAACATACCTCGAGGTATGTTATGCCTGAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012417.2-961s21c1
Sequence:CCGGACAAGGTGGTCCGAGACATTCCTCGAGGAATGTCTCGGACCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012417.2-1318s21c1
Sequence:CCGGATAAGCCATGTCGGCCCAAATCTCGAGATTTGGGCCGACATGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012417.2-610s21c1
Sequence:CCGGACTATTATCCCTACACAATTACTCGAGTAATTGTGTAGGGATAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012417.2-653s1c1
Sequence:CCGGGCCGAAATTCTCCATTCATATCTCGAGATATGAATGGAGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012417.2-1202s1c1
Sequence:CCGGCGAATTTCTGTCCGTTCCCAACTCGAGTTGGGAACGGACAGAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012417.2-381s1c1
Sequence:CCGGCTCACCGTAGACGAGTACAAACTCGAGTTTGTACTCGTCTACGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012417.2-1036s1c1
Sequence:CCGGCAATGGATGAAGTCCGAGAATCTCGAGATTCTCGGACTTCATCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012417.2-528s1c1
Sequence:CCGGCGGGTGTATCTCAACAGCAAACTCGAGTTTGCTGTTGAGATACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks