EMAIL THIS PAGE TO A FRIEND

PITX3

paired-like homeodomain 3

Synonyms: CTPP4 CTRCT11 PTX3
UniProtKB ID: O75364, Q5VZL2
Gene ID:
Human(5309) Summary: This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family act as transcription factors. This protein is involved in lens formation during eye development. Mutations of this gene have been associated with anterior segment mesenchymal dysgenesis and congenital cataracts. [provided by RefSeq, Jul 2008]
Mouse(18742) paired-like homeodomain transcription factor 3
Rat(29609) paired-like homeodomain 3
Zebrafish(402974) paired-like homeodomain transcription factor 3
domestic cat(101084906) paired-like homeodomain 3
dog(486856) paired-like homeodomain 3
chicken(423756) paired-like homeodomain 3
domestic guinea pig(100719527) paired-like homeodomain 3
naked mole-rat(101711768) paired-like homeodomain 3
cow(512000) paired-like homeodomain 3
sheep(100422803) paired-like homeodomain 3
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500800 Anti-PITX3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2108280 Anti-PITX3 antibody produced in rabbit affinity isolated antibody rabbit, canine, human, rat, bovine, guinea pig, mouse, horse, zebrafish
immunohistochemistry, western blot pricing
AV38544 Anti-PITX3 antibody produced in rabbit affinity isolated antibody guinea pig, sheep, human, mouse, rat, rabbit, bovine, canine, horse
western blot pricing
SAB2101815 Anti-PITX3 antibody produced in rabbit affinity isolated antibody rat, guinea pig, bovine, rabbit, human, mouse, canine, horse, sheep
western blot pricing
HPA044639 Anti-PITX3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2103393 Anti-PITX3, (N-terminal) antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, rabbit, bovine, human, rat, zebrafish, mouse, horse, chicken
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005029 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005029 Rosetta Predictions human pricing
NM_019247 Rosetta Predictions rat pricing
NM_008852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054175 predicted 463
2 SASI_Hs01_00054176 predicted 260
3 SASI_Hs01_00054177 predicted 524
4 SASI_Hs01_00054179 predicted 370
5 SASI_Hs01_00054180 predicted 528
6 SASI_Hs01_00054181 predicted 346
7 SASI_Hs01_00054183 predicted 346
8 SASI_Hs01_00054184 predicted 463
9 SASI_Hs02_00338812 predicted 450
10 SASI_Hs02_00338813 predicted 337
11 SASI_Hs01_00054178 predicted 372
12 SASI_Hs01_00054182 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039528 predicted 845
2 SASI_Rn01_00039529 predicted 1004
3 SASI_Rn01_00039530 predicted 922
4 SASI_Rn01_00039531 predicted 961
5 SASI_Rn01_00039532 predicted 494
6 SASI_Rn01_00039533 predicted 215
7 SASI_Rn01_00039534 predicted 868
8 SASI_Rn01_00039535 predicted 297
9 SASI_Rn01_00039536 predicted 315
10 SASI_Rn02_00262122 predicted 614
11 SASI_Rn01_00039527 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083955 predicted 1106
2 SASI_Mm01_00083956 predicted 924
3 SASI_Mm01_00083957 predicted 1039
4 SASI_Mm01_00083958 predicted 570
5 SASI_Mm01_00083959 predicted 710
6 SASI_Mm01_00083960 predicted 942
7 SASI_Mm01_00083961 predicted 706
8 SASI_Mm02_00314793 predicted 196
9 SASI_Mm01_00083962 predicted 692
10 SASI_Mm01_00083963 predicted 394
11 SASI_Mm01_00083964 predicted 1074
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008852
PITX3 MISSION shRNA Bacterial Glycerol Stock
paired-like homeodomain 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-646s1c1
Sequence:CCGGGTTCGCCTTCAACTCGGTCAACTCGAGTTGACCGAGTTGAAGGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-1010s1c1
Sequence:CCGGCCCTGCCAGTACGCCGTGGAACTCGAGTTCCACGGCGTACTGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-176s1c1
Sequence:CCGGGCGCTGTCGTTATCGGACGCACTCGAGTGCGTCCGATAACGACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-556s1c1
Sequence:CCGGGCCACCCTACGAGGAGGTGTACTCGAGTACACCTCCTCGTAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-392s1c1
Sequence:CCGGCCTGACATGAGCACCCGCGAACTCGAGTTCGCGGGTGCTCATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008852.4-711s21c1
Sequence:CCGGAGCTCCATCGCCGCTTCTATGCTCGAGCATAGAAGCGGCGATGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008852.4-955s21c1
Sequence:CCGGAGCACGCCTCTTTCAGCTATCCTCGAGGATAGCTGAAAGAGGCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008852
PITX3 MISSION shRNA shRNA Plasmid DNA
paired-like homeodomain 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-646s1c1
Sequence:CCGGGTTCGCCTTCAACTCGGTCAACTCGAGTTGACCGAGTTGAAGGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-1010s1c1
Sequence:CCGGCCCTGCCAGTACGCCGTGGAACTCGAGTTCCACGGCGTACTGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-176s1c1
Sequence:CCGGGCGCTGTCGTTATCGGACGCACTCGAGTGCGTCCGATAACGACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-556s1c1
Sequence:CCGGGCCACCCTACGAGGAGGTGTACTCGAGTACACCTCCTCGTAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-392s1c1
Sequence:CCGGCCTGACATGAGCACCCGCGAACTCGAGTTCGCGGGTGCTCATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008852.4-711s21c1
Sequence:CCGGAGCTCCATCGCCGCTTCTATGCTCGAGCATAGAAGCGGCGATGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008852.4-955s21c1
Sequence:CCGGAGCACGCCTCTTTCAGCTATCCTCGAGGATAGCTGAAAGAGGCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008852
PITX3 MISSION shRNA Lentiviral Transduction Particles
paired-like homeodomain 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-646s1c1
Sequence:CCGGGTTCGCCTTCAACTCGGTCAACTCGAGTTGACCGAGTTGAAGGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-1010s1c1
Sequence:CCGGCCCTGCCAGTACGCCGTGGAACTCGAGTTCCACGGCGTACTGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-176s1c1
Sequence:CCGGGCGCTGTCGTTATCGGACGCACTCGAGTGCGTCCGATAACGACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-556s1c1
Sequence:CCGGGCCACCCTACGAGGAGGTGTACTCGAGTACACCTCCTCGTAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008852.1-392s1c1
Sequence:CCGGCCTGACATGAGCACCCGCGAACTCGAGTTCGCGGGTGCTCATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008852.4-711s21c1
Sequence:CCGGAGCTCCATCGCCGCTTCTATGCTCGAGCATAGAAGCGGCGATGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008852.4-955s21c1
Sequence:CCGGAGCACGCCTCTTTCAGCTATCCTCGAGGATAGCTGAAAGAGGCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005029
PITX3 MISSION shRNA Bacterial Glycerol Stock
paired-like homeodomain 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005029.3-1191s1c1
Sequence:CCGGACCGGCTCAGGAGAGGGCCTTCTCGAGAAGGCCCTCTCCTGAGCCGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005029.3-1031s1c1
Sequence:CCGGCCGTGCCAGTACGCCGTGGAACTCGAGTTCCACGGCGTACTGGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005029.3-311s1c1
Sequence:CCGGCCAGAGGACGGTTCGCTGAAACTCGAGTTTCAGCGAACCGTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005029.3-671s21c1
Sequence:CCGGGCCTTCAACTCGGTCAACGTGCTCGAGCACGTTGACCGAGTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005029.3-964s21c1
Sequence:CCGGAGCCAAACAGCACGCCTCCTTCTCGAGAAGGAGGCGTGCTGTTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005029.3-261s21c1
Sequence:CCGGAGGAGCACAGCGACTCAGAAACTCGAGTTTCTGAGTCGCTGTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005029
PITX3 MISSION shRNA shRNA Plasmid DNA
paired-like homeodomain 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005029.3-1191s1c1
Sequence:CCGGACCGGCTCAGGAGAGGGCCTTCTCGAGAAGGCCCTCTCCTGAGCCGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005029.3-1031s1c1
Sequence:CCGGCCGTGCCAGTACGCCGTGGAACTCGAGTTCCACGGCGTACTGGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005029.3-311s1c1
Sequence:CCGGCCAGAGGACGGTTCGCTGAAACTCGAGTTTCAGCGAACCGTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005029.3-671s21c1
Sequence:CCGGGCCTTCAACTCGGTCAACGTGCTCGAGCACGTTGACCGAGTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005029.3-964s21c1
Sequence:CCGGAGCCAAACAGCACGCCTCCTTCTCGAGAAGGAGGCGTGCTGTTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005029.3-261s21c1
Sequence:CCGGAGGAGCACAGCGACTCAGAAACTCGAGTTTCTGAGTCGCTGTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005029
PITX3 MISSION shRNA Lentiviral Transduction Particles
paired-like homeodomain 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005029.3-1191s1c1
Sequence:CCGGACCGGCTCAGGAGAGGGCCTTCTCGAGAAGGCCCTCTCCTGAGCCGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005029.3-1031s1c1
Sequence:CCGGCCGTGCCAGTACGCCGTGGAACTCGAGTTCCACGGCGTACTGGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005029.3-311s1c1
Sequence:CCGGCCAGAGGACGGTTCGCTGAAACTCGAGTTTCAGCGAACCGTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005029.3-671s21c1
Sequence:CCGGGCCTTCAACTCGGTCAACGTGCTCGAGCACGTTGACCGAGTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005029.3-964s21c1
Sequence:CCGGAGCCAAACAGCACGCCTCCTTCTCGAGAAGGAGGCGTGCTGTTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005029.3-261s21c1
Sequence:CCGGAGGAGCACAGCGACTCAGAAACTCGAGTTTCTGAGTCGCTGTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks