EMAIL THIS PAGE TO A FRIEND

PKD1

polycystic kidney disease 1 (autosomal dominant)

Synonyms: PBP Pc-1 TRPP1
UniProtKB ID: P98161, Q15140, Q15141
Gene ID:
Human(5310) Summary: This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
Mouse(18763) polycystic kidney disease 1 homolog
Rat(24650) polycystic kidney disease 1 homolog (human)
chicken(416553) polycystic kidney disease 1 (autosomal dominant)
dog(606755) polycystic kidney disease 1 (autosomal dominant)
domestic cat(100144606) polycystic kidney disease 1 (autosomal dominant)
cow(504986) polycystic kidney disease 1 (autosomal dominant)
Domestic Rabbit(100008871) polycystic kidney disease 1 (autosomal dominant)
naked mole-rat(101717562) polycystic kidney disease 1 (autosomal dominant)
domestic guinea pig(100732613) polycystic kidney disease 1 (autosomal dominant)
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C1749 Monoclonal Anti-Polycystin-1 antibody produced in mouse clone PKD46, tissue culture supernatant, buffered aqueous solution human, rat
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000296 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000296 Rosetta Predictions human pricing
NM_001009944 Rosetta Predictions human pricing
XM_340765 Rosetta Predictions rat pricing
NM_013630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136684 predicted 4548
2 SASI_Hs01_00136685 predicted 3498
3 SASI_Hs01_00136686 predicted 3519
4 SASI_Hs01_00136688 predicted 5080
5 SASI_Hs01_00136690 predicted 2255
6 SASI_Hs01_00136693 predicted 5497
7 SASI_Hs02_00302277 predicted 5833
8 SASI_Hs02_00302278 predicted 12243
9 SASI_Hs02_00302279 predicted 3521
10 SASI_Hs02_00302280 predicted 505
11 SASI_Hs01_00136687 predicted 6711
12 SASI_Hs01_00136689 predicted 5760
13 SASI_Hs01_00136691 predicted 11314
14 SASI_Hs01_00136692 predicted 5090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081356 predicted 4547
2 SASI_Hs01_00081357 predicted 3501
3 SASI_Hs01_00081358 predicted 3527
4 SASI_Hs01_00081360 predicted 5081
5 SASI_Hs01_00081362 predicted 2258
6 SASI_Hs01_00081365 predicted 5496
7 SASI_Hs02_00305740 predicted 5839
8 SASI_Hs02_00305741 predicted 12246
9 SASI_Hs02_00305742 predicted 3518
10 SASI_Hs02_00305743 predicted 508
11 SASI_Hs01_00081359 predicted 6704
12 SASI_Hs01_00081361 predicted 5759
13 SASI_Hs01_00081363 predicted 11317
14 SASI_Hs01_00081364 predicted 5086
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193560 predicted 6710
2 SASI_Rn01_00193561 predicted 4817
3 SASI_Rn01_00193562 predicted 9144
4 SASI_Rn01_00193563 predicted 5425
5 SASI_Rn01_00193564 predicted 9788
6 SASI_Rn01_00193565 predicted 7795
7 SASI_Rn01_00193566 predicted 4298
8 SASI_Rn01_00193567 predicted 1238
9 SASI_Rn01_00193568 predicted 3589
10 SASI_Rn01_00193569 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149980 predicted 7760
2 SASI_Mm01_00149981 predicted 3745
3 SASI_Mm01_00149982 predicted 6891
4 SASI_Mm01_00149983 predicted 4779
5 SASI_Mm01_00149984 predicted 1206
6 SASI_Mm01_00149985 predicted 8276
7 SASI_Mm01_00149986 predicted 9528
8 SASI_Mm01_00149987 predicted 7425
9 SASI_Mm01_00149988 predicted 7162
10 SASI_Mm01_00149989 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000296
PKD1 MISSION shRNA Bacterial Glycerol Stock
polycystic kidney disease 1 (autosomal dominant)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000296.3-3517s21c1
Sequence:CCGGTGACCGTGCTGGCATCTAATGCTCGAGCATTAGATGCCAGCACGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-5501s1c1
Sequence:CCGGGCCATTTACCACCCATAGCTTCTCGAGAAGCTATGGGTGGTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-2252s1c1
Sequence:CCGGGCTATGGAGAGAGTTCCTCTTCTCGAGAAGAGGAACTCTCTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-12242s1c1
Sequence:CCGGGTCCGTCTTTGGCAAGACATTCTCGAGAATGTCTTGCCAAAGACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-7775s1c1
Sequence:CCGGCGAGGAGTTCTGTGTCTACAACTCGAGTTGTAGACACAGAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-6895s1c1
Sequence:CCGGGCTTTGTGTTTGTCGTGTCATCTCGAGATGACACGACAAACACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000296
PKD1 MISSION shRNA shRNA Plasmid DNA
polycystic kidney disease 1 (autosomal dominant)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000296.3-3517s21c1
Sequence:CCGGTGACCGTGCTGGCATCTAATGCTCGAGCATTAGATGCCAGCACGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-5501s1c1
Sequence:CCGGGCCATTTACCACCCATAGCTTCTCGAGAAGCTATGGGTGGTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-2252s1c1
Sequence:CCGGGCTATGGAGAGAGTTCCTCTTCTCGAGAAGAGGAACTCTCTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-12242s1c1
Sequence:CCGGGTCCGTCTTTGGCAAGACATTCTCGAGAATGTCTTGCCAAAGACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-7775s1c1
Sequence:CCGGCGAGGAGTTCTGTGTCTACAACTCGAGTTGTAGACACAGAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-6895s1c1
Sequence:CCGGGCTTTGTGTTTGTCGTGTCATCTCGAGATGACACGACAAACACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000296
PKD1 MISSION shRNA Lentiviral Transduction Particles
polycystic kidney disease 1 (autosomal dominant)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000296.3-3517s21c1
Sequence:CCGGTGACCGTGCTGGCATCTAATGCTCGAGCATTAGATGCCAGCACGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-5501s1c1
Sequence:CCGGGCCATTTACCACCCATAGCTTCTCGAGAAGCTATGGGTGGTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-2252s1c1
Sequence:CCGGGCTATGGAGAGAGTTCCTCTTCTCGAGAAGAGGAACTCTCTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-12242s1c1
Sequence:CCGGGTCCGTCTTTGGCAAGACATTCTCGAGAATGTCTTGCCAAAGACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-7775s1c1
Sequence:CCGGCGAGGAGTTCTGTGTCTACAACTCGAGTTGTAGACACAGAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000296.2-6895s1c1
Sequence:CCGGGCTTTGTGTTTGTCGTGTCATCTCGAGATGACACGACAAACACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013630
VALIDATED
PKD1 MISSION shRNA Bacterial Glycerol Stock
polycystic kidney disease 1 (autosomal dominant)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013630.2-12257s21c1
Sequence:CCGGGCTTCACTACTCTTCCTGCTTCTCGAGAAGCAGGAAGAGTAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013630.2-3559s21c1
Sequence:CCGGACACAATACCACGCATATTTACTCGAGTAAATATGCGTGGTATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013630.2-7519s21c1
Sequence:CCGGCGCTCGCACTTTCAGCAATAACTCGAGTTATTGCTGAAAGTGCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013630.2-13264s21c1
Sequence:CCGGGGTGGACACCACTCAGTATTACTCGAGTAATACTGAGTGGTGTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013630.2-3753s21c1
Sequence:CCGGCAACTGATGGTGTCCTATATACTCGAGTATATAGGACACCATCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-7521s1c1
Sequence:CCGGCGCTCGCACTTTCAGCAATAACTCGAGTTATTGCTGAAAGTGCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-7076s1c1
Sequence:CCGGCCATCATTGAAGGTGGCTCATCTCGAGATGAGCCACCTTCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-12259s1c1
Sequence:CCGGGCTTCACTACTCTTCCTGCTTCTCGAGAAGCAGGAAGAGTAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-4911s1c1
Sequence:CCGGCCAACTCAACATCACCGTAAACTCGAGTTTACGGTGATGTTGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-2515s1c1
Sequence:CCGGGCCCTGTACCTTTCAACCAATCTCGAGATTGGTTGAAAGGTACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013630
VALIDATED
PKD1 MISSION shRNA shRNA Plasmid DNA
polycystic kidney disease 1 (autosomal dominant)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013630.2-12257s21c1
Sequence:CCGGGCTTCACTACTCTTCCTGCTTCTCGAGAAGCAGGAAGAGTAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013630.2-3559s21c1
Sequence:CCGGACACAATACCACGCATATTTACTCGAGTAAATATGCGTGGTATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013630.2-7519s21c1
Sequence:CCGGCGCTCGCACTTTCAGCAATAACTCGAGTTATTGCTGAAAGTGCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013630.2-13264s21c1
Sequence:CCGGGGTGGACACCACTCAGTATTACTCGAGTAATACTGAGTGGTGTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013630.2-3753s21c1
Sequence:CCGGCAACTGATGGTGTCCTATATACTCGAGTATATAGGACACCATCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-7521s1c1
Sequence:CCGGCGCTCGCACTTTCAGCAATAACTCGAGTTATTGCTGAAAGTGCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-7076s1c1
Sequence:CCGGCCATCATTGAAGGTGGCTCATCTCGAGATGAGCCACCTTCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-12259s1c1
Sequence:CCGGGCTTCACTACTCTTCCTGCTTCTCGAGAAGCAGGAAGAGTAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-4911s1c1
Sequence:CCGGCCAACTCAACATCACCGTAAACTCGAGTTTACGGTGATGTTGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-2515s1c1
Sequence:CCGGGCCCTGTACCTTTCAACCAATCTCGAGATTGGTTGAAAGGTACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013630
VALIDATED
PKD1 MISSION shRNA Lentiviral Transduction Particles
polycystic kidney disease 1 (autosomal dominant)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013630.2-12257s21c1
Sequence:CCGGGCTTCACTACTCTTCCTGCTTCTCGAGAAGCAGGAAGAGTAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013630.2-3559s21c1
Sequence:CCGGACACAATACCACGCATATTTACTCGAGTAAATATGCGTGGTATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013630.2-7519s21c1
Sequence:CCGGCGCTCGCACTTTCAGCAATAACTCGAGTTATTGCTGAAAGTGCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013630.2-13264s21c1
Sequence:CCGGGGTGGACACCACTCAGTATTACTCGAGTAATACTGAGTGGTGTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013630.2-3753s21c1
Sequence:CCGGCAACTGATGGTGTCCTATATACTCGAGTATATAGGACACCATCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-7521s1c1
Sequence:CCGGCGCTCGCACTTTCAGCAATAACTCGAGTTATTGCTGAAAGTGCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-7076s1c1
Sequence:CCGGCCATCATTGAAGGTGGCTCATCTCGAGATGAGCCACCTTCAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-12259s1c1
Sequence:CCGGGCTTCACTACTCTTCCTGCTTCTCGAGAAGCAGGAAGAGTAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-4911s1c1
Sequence:CCGGCCAACTCAACATCACCGTAAACTCGAGTTTACGGTGATGTTGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013630.1-2515s1c1
Sequence:CCGGGCCCTGTACCTTTCAACCAATCTCGAGATTGGTTGAAAGGTACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks