EMAIL THIS PAGE TO A FRIEND

PKD2L1

polycystic kidney disease 2-like 1

Synonyms: PCL PKD2L PKDL TRPP3
UniProtKB ID: Q9P0L9, O75972, Q5W039, Q9UP35, Q9UPA2
Gene ID:
Human(9033) Summary: This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains, and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(329064) polycystic kidney disease 2-like 1
Rat(293937) polycystic kidney disease 2-like 1
Domestic Rabbit(100356650) polycystic kidney disease 2-like 1
naked mole-rat(101720598) polycystic kidney disease 2-like 1
domestic guinea pig(100719385) polycystic kidney disease 2-like 1
cow(521231) polycystic kidney disease 2-like 1
sheep(101111411) polycystic kidney disease 2-like 1
Zebrafish(567026) polycystic kidney disease 2-like 1
Horse(100070385) polycystic kidney disease 2-like 1
domestic cat(101095860) polycystic kidney disease 2-like 1
dog(486838) polycystic kidney disease 2-like 1
chicken(428954) polycystic kidney disease 2-like 1
Gene Class: Cytoskeleton
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016112 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016112 Rosetta Predictions human pricing
NM_001106352 Rosetta Predictions rat pricing
NM_181422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117588 predicted 584
2 SASI_Hs01_00117589 predicted 2135
3 SASI_Hs01_00117590 predicted 1994
4 SASI_Hs01_00117591 predicted 2007
5 SASI_Hs01_00117592 predicted 1117
6 SASI_Hs01_00117593 predicted 626
7 SASI_Hs01_00117594 predicted 2556
8 SASI_Hs01_00117595 predicted 2251
9 SASI_Hs01_00117596 predicted 1729
10 SASI_Hs01_00117597 predicted 2822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218128 predicted 2001
2 SASI_Rn02_00218129 predicted 1786
3 SASI_Rn02_00218130 predicted 1528
4 SASI_Rn02_00218131 predicted 1508
5 SASI_Rn02_00218132 predicted 1191
6 SASI_Rn02_00218133 predicted 827
7 SASI_Rn02_00218134 predicted 1735
8 SASI_Rn02_00218135 predicted 837
9 SASI_Rn02_00218136 predicted 868
10 SASI_Rn02_00218137 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028791 predicted 2304
2 SASI_Mm01_00028792 predicted 1888
3 SASI_Mm01_00028794 predicted 585
4 SASI_Mm01_00028795 predicted 1902
5 SASI_Mm01_00028796 predicted 309
6 SASI_Mm01_00028797 predicted 475
7 SASI_Mm01_00028798 predicted 2285
8 SASI_Mm01_00028799 predicted 2149
9 SASI_Mm01_00028800 predicted 1729
10 SASI_Mm02_00349780 predicted 477
11 SASI_Mm01_00028793 predicted 868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181422
PKD2L1 MISSION shRNA Bacterial Glycerol Stock
polycystic kidney disease 2-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181422.2-2735s1c1
Sequence:CCGGGCCAGAGTTGATTGACATCAACTCGAGTTGATGTCAATCAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181422.2-487s1c1
Sequence:CCGGCCTACGGAATGACAAGTTCTACTCGAGTAGAACTTGTCATTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181422.2-641s1c1
Sequence:CCGGGTACTGGACAAAGTGGTACAACTCGAGTTGTACCACTTTGTCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181422.2-1745s1c1
Sequence:CCGGCCCTGTGTACTTTGTCACCTACTCGAGTAGGTGACAAAGTACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181422.2-1398s1c1
Sequence:CCGGCCAGACACGTATGCAGACTTTCTCGAGAAAGTCTGCATACGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181422
PKD2L1 MISSION shRNA shRNA Plasmid DNA
polycystic kidney disease 2-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181422.2-2735s1c1
Sequence:CCGGGCCAGAGTTGATTGACATCAACTCGAGTTGATGTCAATCAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181422.2-487s1c1
Sequence:CCGGCCTACGGAATGACAAGTTCTACTCGAGTAGAACTTGTCATTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181422.2-641s1c1
Sequence:CCGGGTACTGGACAAAGTGGTACAACTCGAGTTGTACCACTTTGTCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181422.2-1745s1c1
Sequence:CCGGCCCTGTGTACTTTGTCACCTACTCGAGTAGGTGACAAAGTACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181422.2-1398s1c1
Sequence:CCGGCCAGACACGTATGCAGACTTTCTCGAGAAAGTCTGCATACGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181422
PKD2L1 MISSION shRNA Lentiviral Transduction Particles
polycystic kidney disease 2-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181422.2-2735s1c1
Sequence:CCGGGCCAGAGTTGATTGACATCAACTCGAGTTGATGTCAATCAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181422.2-487s1c1
Sequence:CCGGCCTACGGAATGACAAGTTCTACTCGAGTAGAACTTGTCATTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181422.2-641s1c1
Sequence:CCGGGTACTGGACAAAGTGGTACAACTCGAGTTGTACCACTTTGTCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181422.2-1745s1c1
Sequence:CCGGCCCTGTGTACTTTGTCACCTACTCGAGTAGGTGACAAAGTACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181422.2-1398s1c1
Sequence:CCGGCCAGACACGTATGCAGACTTTCTCGAGAAAGTCTGCATACGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016112
PKD2L1 MISSION shRNA Bacterial Glycerol Stock
polycystic kidney disease 2-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-1824s1c1
Sequence:CCGGGCCGTCATGTTCTTCATTGTTCTCGAGAACAATGAAGAACATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-873s1c1
Sequence:CCGGCCACTACTGGACAGTTTGTATCTCGAGATACAAACTGTCCAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-593s1c1
Sequence:CCGGCCTCCATATCTGTCAAGGCATCTCGAGATGCCTTGACAGATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-2055s1c1
Sequence:CCGGGCCATCATCAATGACACATATCTCGAGATATGTGTCATTGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-2482s1c1
Sequence:CCGGGCTGGGTTTCAGGAGAAGAATCTCGAGATTCTTCTCCTGAAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016112.2-2144s21c1
Sequence:CCGGCTACAACAAGACCCTACTAAGCTCGAGCTTAGTAGGGTCTTGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016112.2-2565s21c1
Sequence:CCGGATTGATGCTGTAGGCTCAAAGCTCGAGCTTTGAGCCTACAGCATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016112.2-1957s21c1
Sequence:CCGGACTACAATGCTATCGACAATGCTCGAGCATTGTCGATAGCATTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016112.2-934s21c1
Sequence:CCGGCCCACTCCTTCATCTACTATGCTCGAGCATAGTAGATGAAGGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016112
PKD2L1 MISSION shRNA shRNA Plasmid DNA
polycystic kidney disease 2-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-1824s1c1
Sequence:CCGGGCCGTCATGTTCTTCATTGTTCTCGAGAACAATGAAGAACATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-873s1c1
Sequence:CCGGCCACTACTGGACAGTTTGTATCTCGAGATACAAACTGTCCAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-593s1c1
Sequence:CCGGCCTCCATATCTGTCAAGGCATCTCGAGATGCCTTGACAGATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-2055s1c1
Sequence:CCGGGCCATCATCAATGACACATATCTCGAGATATGTGTCATTGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-2482s1c1
Sequence:CCGGGCTGGGTTTCAGGAGAAGAATCTCGAGATTCTTCTCCTGAAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016112.2-2144s21c1
Sequence:CCGGCTACAACAAGACCCTACTAAGCTCGAGCTTAGTAGGGTCTTGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016112.2-2565s21c1
Sequence:CCGGATTGATGCTGTAGGCTCAAAGCTCGAGCTTTGAGCCTACAGCATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016112.2-1957s21c1
Sequence:CCGGACTACAATGCTATCGACAATGCTCGAGCATTGTCGATAGCATTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016112.2-934s21c1
Sequence:CCGGCCCACTCCTTCATCTACTATGCTCGAGCATAGTAGATGAAGGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016112
PKD2L1 MISSION shRNA Lentiviral Transduction Particles
polycystic kidney disease 2-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-1824s1c1
Sequence:CCGGGCCGTCATGTTCTTCATTGTTCTCGAGAACAATGAAGAACATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-873s1c1
Sequence:CCGGCCACTACTGGACAGTTTGTATCTCGAGATACAAACTGTCCAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-593s1c1
Sequence:CCGGCCTCCATATCTGTCAAGGCATCTCGAGATGCCTTGACAGATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-2055s1c1
Sequence:CCGGGCCATCATCAATGACACATATCTCGAGATATGTGTCATTGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016112.2-2482s1c1
Sequence:CCGGGCTGGGTTTCAGGAGAAGAATCTCGAGATTCTTCTCCTGAAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016112.2-2144s21c1
Sequence:CCGGCTACAACAAGACCCTACTAAGCTCGAGCTTAGTAGGGTCTTGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016112.2-2565s21c1
Sequence:CCGGATTGATGCTGTAGGCTCAAAGCTCGAGCTTTGAGCCTACAGCATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016112.2-1957s21c1
Sequence:CCGGACTACAATGCTATCGACAATGCTCGAGCATTGTCGATAGCATTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016112.2-934s21c1
Sequence:CCGGCCCACTCCTTCATCTACTATGCTCGAGCATAGTAGATGAAGGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks