EMAIL THIS PAGE TO A FRIEND

PKDCC

protein kinase domain containing, cytoplasmic

Synonyms: SGK493 Vlk
UniProtKB ID: Q504Y2, D6W5A0, Q96I09
Gene ID:
Mouse(106522) protein kinase domain containing, cytoplasmic
Rat(313860) protein kinase domain containing, cytoplasmic
chicken(423451) protein kinase domain containing, cytoplasmic homolog (mouse)
domestic cat(101094841) protein kinase domain containing, cytoplasmic homolog (mouse)
dog(611604) protein kinase domain containing, cytoplasmic homolog (mouse)
naked mole-rat(101715304) protein kinase domain containing, cytoplasmic
domestic guinea pig(100723658) protein kinase domain containing, cytoplasmic
cow(539467) protein kinase domain containing, cytoplasmic homolog (mouse)
sheep(101116218) protein kinase domain containing, cytoplasmic homolog (mouse)
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_038576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_038576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_038576 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_128778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_134117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138370 Rosetta Predictions human pricing
NM_001108007 Rosetta Predictions rat pricing
NM_134117 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221552 predicted 1222
2 SASI_Hs01_00221553 predicted 1502
3 SASI_Hs02_00363483 predicted 422
4 SASI_Hs01_00221554 predicted 802
5 SASI_Hs01_00221555 predicted 1083
6 SASI_Hs01_00221556 predicted 1247
7 SASI_Hs01_00221557 predicted 579
8 SASI_Hs01_00221558 predicted 1031
9 SASI_Hs01_00221559 predicted 297
10 SASI_Hs01_00221561 predicted 588
11 SASI_Hs01_00221560 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234445 predicted 345
2 SASI_Rn02_00234446 predicted 317
3 SASI_Rn02_00234447 predicted 693
4 SASI_Rn02_00234448 predicted 449
5 SASI_Rn02_00234449 predicted 633
6 SASI_Rn02_00234450 predicted 942
7 SASI_Rn02_00234451 predicted 789
8 SASI_Rn02_00234452 predicted 682
9 SASI_Rn02_00234453 predicted 607
10 SASI_Rn02_00234454 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195210 predicted 751
2 SASI_Mm01_00195211 predicted 1660
3 SASI_Mm01_00195213 predicted 1750
4 SASI_Mm01_00195214 predicted 1458
5 SASI_Mm02_00339363 predicted 908
6 SASI_Mm01_00195215 predicted 1326
7 SASI_Mm01_00195216 predicted 1690
8 SASI_Mm01_00195217 predicted 1670
9 SASI_Mm02_00339364 predicted 1278
10 SASI_Mm01_00195219 predicted 1097
11 SASI_Mm01_00195212 predicted 1849
12 SASI_Mm01_00195218 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138370
VALIDATED
PKDCC MISSION shRNA Bacterial Glycerol Stock
protein kinase domain containing, cytoplasmic
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138370.1-455s1c1
Sequence:CCGGGAGCTCAAAGTGACGGACCTGCTCGAGCAGGTCCGTCACTTTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138370.1-1031s1c1
Sequence:CCGGGATCCCAACAAGACCACATATCTCGAGATATGTGGTCTTGTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138370.1-1003s1c1
Sequence:CCGGCAAGACTGGATGGAGCCAAGTCTCGAGACTTGGCTCCATCCAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138370.1-874s1c1
Sequence:CCGGCCACGGGAGCTGCCTCCTTTCCTCGAGGAAAGGAGGCAGCTCCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1595s21c1
Sequence:CCGGCAAGACTGGATGGAGCCAAGTCTCGAGACTTGGCTCCATCCAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1190s21c1
Sequence:CCGGGCGGAACCTCTATAATGCCTACTCGAGTAGGCATTATAGAGGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1475s21c1
Sequence:CCGGCTGCCTCCTTTCAGTGTTCAACTCGAGTTGAACACTGAAAGGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1394s21c1
Sequence:CCGGCAGTACCGAGTACCAGTGTATCTCGAGATACACTGGTACTCGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1623s21c1
Sequence:CCGGGATCCCAACAAGACCACATATCTCGAGATATGTGGTCTTGTTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138370
VALIDATED
PKDCC MISSION shRNA shRNA Plasmid DNA
protein kinase domain containing, cytoplasmic
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138370.1-455s1c1
Sequence:CCGGGAGCTCAAAGTGACGGACCTGCTCGAGCAGGTCCGTCACTTTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138370.1-1031s1c1
Sequence:CCGGGATCCCAACAAGACCACATATCTCGAGATATGTGGTCTTGTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138370.1-1003s1c1
Sequence:CCGGCAAGACTGGATGGAGCCAAGTCTCGAGACTTGGCTCCATCCAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138370.1-874s1c1
Sequence:CCGGCCACGGGAGCTGCCTCCTTTCCTCGAGGAAAGGAGGCAGCTCCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1595s21c1
Sequence:CCGGCAAGACTGGATGGAGCCAAGTCTCGAGACTTGGCTCCATCCAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1190s21c1
Sequence:CCGGGCGGAACCTCTATAATGCCTACTCGAGTAGGCATTATAGAGGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1475s21c1
Sequence:CCGGCTGCCTCCTTTCAGTGTTCAACTCGAGTTGAACACTGAAAGGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1394s21c1
Sequence:CCGGCAGTACCGAGTACCAGTGTATCTCGAGATACACTGGTACTCGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1623s21c1
Sequence:CCGGGATCCCAACAAGACCACATATCTCGAGATATGTGGTCTTGTTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138370
VALIDATED
PKDCC MISSION shRNA Lentiviral Transduction Particles
protein kinase domain containing, cytoplasmic
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138370.1-455s1c1
Sequence:CCGGGAGCTCAAAGTGACGGACCTGCTCGAGCAGGTCCGTCACTTTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138370.1-1031s1c1
Sequence:CCGGGATCCCAACAAGACCACATATCTCGAGATATGTGGTCTTGTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138370.1-1003s1c1
Sequence:CCGGCAAGACTGGATGGAGCCAAGTCTCGAGACTTGGCTCCATCCAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138370.1-874s1c1
Sequence:CCGGCCACGGGAGCTGCCTCCTTTCCTCGAGGAAAGGAGGCAGCTCCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1595s21c1
Sequence:CCGGCAAGACTGGATGGAGCCAAGTCTCGAGACTTGGCTCCATCCAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1190s21c1
Sequence:CCGGGCGGAACCTCTATAATGCCTACTCGAGTAGGCATTATAGAGGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1475s21c1
Sequence:CCGGCTGCCTCCTTTCAGTGTTCAACTCGAGTTGAACACTGAAAGGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1394s21c1
Sequence:CCGGCAGTACCGAGTACCAGTGTATCTCGAGATACACTGGTACTCGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138370.2-1623s21c1
Sequence:CCGGGATCCCAACAAGACCACATATCTCGAGATATGTGGTCTTGTTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_038576
VALIDATED
PKDCC MISSION shRNA Bacterial Glycerol Stock
protein kinase domain containing, cytoplasmic
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:XM_038576.7-686s1c1
Sequence:CCGGGCGGAACCTCTATAATGCCTACTCGAGTAGGCATTATAGAGGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_038576.7-971s1c1
Sequence:CCGGCTGCCTCCTTTCAGTGTTCAACTCGAGTTGAACACTGAAAGGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:XM_038576.7-692s1c1
Sequence:CCGGCCTCTATAATGCCTACAGGTTCTCGAGAACCTGTAGGCATTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038576.7-311s1c1
Sequence:CCGGGCAGCTCTATGGCTACTGCTACTCGAGTAGCAGTAGCCATAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:XM_038576.7-890s1c1
Sequence:CCGGCAGTACCGAGTACCAGTGTATCTCGAGATACACTGGTACTCGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_038576
VALIDATED
PKDCC MISSION shRNA shRNA Plasmid DNA
protein kinase domain containing, cytoplasmic
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:XM_038576.7-686s1c1
Sequence:CCGGGCGGAACCTCTATAATGCCTACTCGAGTAGGCATTATAGAGGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_038576.7-971s1c1
Sequence:CCGGCTGCCTCCTTTCAGTGTTCAACTCGAGTTGAACACTGAAAGGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:XM_038576.7-692s1c1
Sequence:CCGGCCTCTATAATGCCTACAGGTTCTCGAGAACCTGTAGGCATTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038576.7-311s1c1
Sequence:CCGGGCAGCTCTATGGCTACTGCTACTCGAGTAGCAGTAGCCATAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:XM_038576.7-890s1c1
Sequence:CCGGCAGTACCGAGTACCAGTGTATCTCGAGATACACTGGTACTCGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_038576
VALIDATED
PKDCC MISSION shRNA Lentiviral Transduction Particles
protein kinase domain containing, cytoplasmic
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:XM_038576.7-686s1c1
Sequence:CCGGGCGGAACCTCTATAATGCCTACTCGAGTAGGCATTATAGAGGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_038576.7-971s1c1
Sequence:CCGGCTGCCTCCTTTCAGTGTTCAACTCGAGTTGAACACTGAAAGGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:XM_038576.7-692s1c1
Sequence:CCGGCCTCTATAATGCCTACAGGTTCTCGAGAACCTGTAGGCATTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_038576.7-311s1c1
Sequence:CCGGGCAGCTCTATGGCTACTGCTACTCGAGTAGCAGTAGCCATAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:XM_038576.7-890s1c1
Sequence:CCGGCAGTACCGAGTACCAGTGTATCTCGAGATACACTGGTACTCGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128778
PKDCC MISSION shRNA Bacterial Glycerol Stock
protein kinase domain containing, cytoplasmic
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-650s1c1
Sequence:CCGGCCTCTACAATGCCTACAGGTTCTCGAGAACCTGTAGGCATTGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-1079s1c1
Sequence:CCGGCGGCAAGACCACATATGTGAACTCGAGTTCACATATGTGGTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-662s1c1
Sequence:CCGGCTACAGGTTCTTCTTCACATACTCGAGTATGTGAAGAAGAACCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-269s1c1
Sequence:CCGGGCAGCTCTATGGCTATTGCTACTCGAGTAGCAATAGCCATAGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-876s1c1
Sequence:CCGGGCCATCACACAGGAGGACTATCTCGAGATAGTCCTCCTGTGTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128778
PKDCC MISSION shRNA shRNA Plasmid DNA
protein kinase domain containing, cytoplasmic
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-650s1c1
Sequence:CCGGCCTCTACAATGCCTACAGGTTCTCGAGAACCTGTAGGCATTGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-1079s1c1
Sequence:CCGGCGGCAAGACCACATATGTGAACTCGAGTTCACATATGTGGTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-662s1c1
Sequence:CCGGCTACAGGTTCTTCTTCACATACTCGAGTATGTGAAGAAGAACCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-269s1c1
Sequence:CCGGGCAGCTCTATGGCTATTGCTACTCGAGTAGCAATAGCCATAGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-876s1c1
Sequence:CCGGGCCATCACACAGGAGGACTATCTCGAGATAGTCCTCCTGTGTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128778
PKDCC MISSION shRNA Lentiviral Transduction Particles
protein kinase domain containing, cytoplasmic
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-650s1c1
Sequence:CCGGCCTCTACAATGCCTACAGGTTCTCGAGAACCTGTAGGCATTGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-1079s1c1
Sequence:CCGGCGGCAAGACCACATATGTGAACTCGAGTTCACATATGTGGTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-662s1c1
Sequence:CCGGCTACAGGTTCTTCTTCACATACTCGAGTATGTGAAGAAGAACCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-269s1c1
Sequence:CCGGGCAGCTCTATGGCTATTGCTACTCGAGTAGCAATAGCCATAGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128778.5-876s1c1
Sequence:CCGGGCCATCACACAGGAGGACTATCTCGAGATAGTCCTCCTGTGTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134117
PKDCC MISSION shRNA Bacterial Glycerol Stock
protein kinase domain containing, cytoplasmic
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134117.2-1770s21c1
Sequence:CCGGGACCAGGACAAACGTGCAATACTCGAGTATTGCACGTTTGTCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134117.2-1493s21c1
Sequence:CCGGTCAACCTGGCTGAGGCTATAGCTCGAGCTATAGCCTCAGCCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134117.2-816s21c1
Sequence:CCGGGCTGCAGCTCTATGGCTATTGCTCGAGCAATAGCCATAGAGCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134117.2-1624s21c1
Sequence:CCGGGATGCCGGCAAGACCACATATCTCGAGATATGTGGTCTTGCCGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134117
PKDCC MISSION shRNA shRNA Plasmid DNA
protein kinase domain containing, cytoplasmic
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134117.2-1770s21c1
Sequence:CCGGGACCAGGACAAACGTGCAATACTCGAGTATTGCACGTTTGTCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134117.2-1493s21c1
Sequence:CCGGTCAACCTGGCTGAGGCTATAGCTCGAGCTATAGCCTCAGCCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134117.2-816s21c1
Sequence:CCGGGCTGCAGCTCTATGGCTATTGCTCGAGCAATAGCCATAGAGCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134117.2-1624s21c1
Sequence:CCGGGATGCCGGCAAGACCACATATCTCGAGATATGTGGTCTTGCCGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134117
PKDCC MISSION shRNA Lentiviral Transduction Particles
protein kinase domain containing, cytoplasmic
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134117.2-1770s21c1
Sequence:CCGGGACCAGGACAAACGTGCAATACTCGAGTATTGCACGTTTGTCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134117.2-1493s21c1
Sequence:CCGGTCAACCTGGCTGAGGCTATAGCTCGAGCTATAGCCTCAGCCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134117.2-816s21c1
Sequence:CCGGGCTGCAGCTCTATGGCTATTGCTCGAGCAATAGCCATAGAGCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134117.2-1624s21c1
Sequence:CCGGGATGCCGGCAAGACCACATATCTCGAGATATGTGGTCTTGCCGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks