EMAIL THIS PAGE TO A FRIEND

PKHD1

polycystic kidney and hepatic disease 1 (autosomal recessive)

Synonyms: ARPKD FCYT TIGM1
UniProtKB ID: P08F94, Q5VUA2, Q5VUA3, Q5VWV1, Q86Z26, Q8TCZ9
Gene ID:
Human(5314) Summary: The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
Mouse(241035) polycystic kidney and hepatic disease 1
Rat(301287) polycystic kidney and hepatic disease 1
chicken(422044) polycystic kidney and hepatic disease 1 (autosomal recessive)
dog(474934) polycystic kidney and hepatic disease 1 (autosomal recessive)
domestic cat(101095100) polycystic kidney and hepatic disease 1 (autosomal recessive)
Horse(100069045) polycystic kidney and hepatic disease 1 (autosomal recessive)
cow(101908994) polycystic kidney and hepatic disease 1 (autosomal recessive)
sheep(101103679) polycystic kidney and hepatic disease 1 (autosomal recessive)
naked mole-rat(101720073) polycystic kidney and hepatic disease 1 (autosomal recessive)
domestic guinea pig(100735018) polycystic kidney and hepatic disease 1 (autosomal recessive)
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138694 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138694 Rosetta Predictions human pricing
NM_170724 Rosetta Predictions human pricing
XM_001070557 Rosetta Predictions rat pricing
XM_236979 Rosetta Predictions rat pricing
NM_153179 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235616 predicted 2771
2 SASI_Hs01_00235618 predicted 9140
3 SASI_Hs01_00235619 predicted 7595
4 SASI_Hs01_00235620 predicted 6569
5 SASI_Hs01_00235621 predicted 8268
6 SASI_Hs02_00363789 predicted 8366
7 SASI_Hs02_00363790 predicted 1447
8 SASI_Hs02_00363791 predicted 3390
9 SASI_Hs01_00235623 predicted 5962
10 SASI_Hs02_00363792 predicted 1493
11 SASI_Hs01_00235617 predicted 7589
12 SASI_Hs01_00235622 predicted 1720
13 SASI_Hs01_00235624 predicted 7988
14 SASI_Hs01_00235625 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230452 predicted 2774
2 SASI_Hs01_00230454 predicted 9144
3 SASI_Hs01_00230455 predicted 7590
4 SASI_Hs01_00230456 predicted 6576
5 SASI_Hs01_00230457 predicted 8262
6 SASI_Hs02_00367682 predicted 8373
7 SASI_Hs02_00367683 predicted 1444
8 SASI_Hs02_00367684 predicted 3396
9 SASI_Hs01_00230459 predicted 5959
10 SASI_Hs02_00367685 predicted 1492
11 SASI_Hs01_00230453 predicted 7582
12 SASI_Hs01_00230458 predicted 1714
13 SASI_Hs01_00230460 predicted 7991
14 SASI_Hs01_00230461 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332067 predicted 2023
2 SASI_Rn02_00332068 predicted 7889
3 SASI_Rn02_00332069 predicted 4117
4 SASI_Rn02_00332070 predicted 8120
5 SASI_Rn02_00332071 predicted 676
6 SASI_Rn02_00332072 predicted 9430
7 SASI_Rn02_00332073 predicted 2836
8 SASI_Rn02_00332074 predicted 6667
9 SASI_Rn02_00332075 predicted 1044
10 SASI_Rn02_00332076 predicted 6625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390580 predicted 2149
2 SASI_Rn02_00390581 predicted 6450
3 SASI_Rn02_00390582 predicted 6675
4 SASI_Rn02_00390583 predicted 807
5 SASI_Rn02_00390584 predicted 8000
6 SASI_Rn02_00390585 predicted 6230
7 SASI_Rn02_00390586 predicted 2969
8 SASI_Rn02_00390587 predicted 10007
9 SASI_Rn02_00390588 predicted 5231
10 SASI_Rn02_00390589 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343107 predicted 2049
2 SASI_Mm01_00051419 predicted 8021
3 SASI_Mm01_00051422 predicted 10476
4 SASI_Mm02_00343108 predicted 4581
5 SASI_Mm01_00051424 predicted 7609
6 SASI_Mm02_00343109 predicted 11020
7 SASI_Mm02_00343110 predicted 11260
8 SASI_Mm01_00051425 predicted 11098
9 SASI_Mm01_00051426 predicted 6883
10 SASI_Mm02_00343111 predicted 11483
11 SASI_Mm01_00051420 predicted 11170
12 SASI_Mm01_00051421 predicted 8149
13 SASI_Mm01_00051423 predicted 2030
14 SASI_Mm01_00051427 predicted 2032
15 SASI_Mm01_00051428 predicted 3047
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153179
VALIDATED
PKHD1 MISSION shRNA Bacterial Glycerol Stock
polycystic kidney and hepatic disease 1 (autosomal recessive)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153179.2-6533s1c1
Sequence:CCGGCCTGAGATATTCCTATGATTTCTCGAGAAATCATAGGAATATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153179.2-3921s1c1
Sequence:CCGGCCTTGTGATATTGTGAACTTACTCGAGTAAGTTCACAATATCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153179.2-990s1c1
Sequence:CCGGCCAGAAATCTTATCCGTGTTTCTCGAGAAACACGGATAAGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153179.2-12685s1c1
Sequence:CCGGGCCAACTTAATACCTGTGCTACTCGAGTAGCACAGGTATTAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153179.3-8840s21c1
Sequence:CCGGCCGGGAAATGAGAGGATTATTCTCGAGAATAATCCTCTCATTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153179.3-10351s21c1
Sequence:CCGGGTTCCTCAATACAGGTATATTCTCGAGAATATACCTGTATTGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153179.3-4978s21c1
Sequence:CCGGTGGAAGTCTCTTGACGATAAACTCGAGTTTATCGTCAAGAGACTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153179
VALIDATED
PKHD1 MISSION shRNA shRNA Plasmid DNA
polycystic kidney and hepatic disease 1 (autosomal recessive)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153179.2-6533s1c1
Sequence:CCGGCCTGAGATATTCCTATGATTTCTCGAGAAATCATAGGAATATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153179.2-3921s1c1
Sequence:CCGGCCTTGTGATATTGTGAACTTACTCGAGTAAGTTCACAATATCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153179.2-990s1c1
Sequence:CCGGCCAGAAATCTTATCCGTGTTTCTCGAGAAACACGGATAAGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153179.2-12685s1c1
Sequence:CCGGGCCAACTTAATACCTGTGCTACTCGAGTAGCACAGGTATTAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153179.3-8840s21c1
Sequence:CCGGCCGGGAAATGAGAGGATTATTCTCGAGAATAATCCTCTCATTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153179.3-10351s21c1
Sequence:CCGGGTTCCTCAATACAGGTATATTCTCGAGAATATACCTGTATTGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153179.3-4978s21c1
Sequence:CCGGTGGAAGTCTCTTGACGATAAACTCGAGTTTATCGTCAAGAGACTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153179
VALIDATED
PKHD1 MISSION shRNA Lentiviral Transduction Particles
polycystic kidney and hepatic disease 1 (autosomal recessive)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153179.2-6533s1c1
Sequence:CCGGCCTGAGATATTCCTATGATTTCTCGAGAAATCATAGGAATATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153179.2-3921s1c1
Sequence:CCGGCCTTGTGATATTGTGAACTTACTCGAGTAAGTTCACAATATCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153179.2-990s1c1
Sequence:CCGGCCAGAAATCTTATCCGTGTTTCTCGAGAAACACGGATAAGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153179.2-12685s1c1
Sequence:CCGGGCCAACTTAATACCTGTGCTACTCGAGTAGCACAGGTATTAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153179.3-8840s21c1
Sequence:CCGGCCGGGAAATGAGAGGATTATTCTCGAGAATAATCCTCTCATTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153179.3-10351s21c1
Sequence:CCGGGTTCCTCAATACAGGTATATTCTCGAGAATATACCTGTATTGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153179.3-4978s21c1
Sequence:CCGGTGGAAGTCTCTTGACGATAAACTCGAGTTTATCGTCAAGAGACTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138694
PKHD1 MISSION shRNA Bacterial Glycerol Stock
polycystic kidney and hepatic disease 1 (autosomal recessive)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-9767s1c1
Sequence:CCGGGCGTGGAGATAGAGAACATTACTCGAGTAATGTTCTCTATCTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-2369s1c1
Sequence:CCGGGCCTGTTCTATGTGGATGAAACTCGAGTTTCATCCACATAGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-685s1c1
Sequence:CCGGCCCATCGTTCACCAAGTTTATCTCGAGATAAACTTGGTGAACGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-10843s1c1
Sequence:CCGGGCTTCCTTATTGCTGAATGAACTCGAGTTCATTCAGCAATAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-5179s1c1
Sequence:CCGGGCCCTGGAAATAGAGGTAGATCTCGAGATCTACCTCTATTTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138694.3-3409s21c1
Sequence:CCGGGAAGGTGTTAGCCTGATATTACTCGAGTAATATCAGGCTAACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138694.3-9126s21c1
Sequence:CCGGTGGACTGTTGACCCGAAATATCTCGAGATATTTCGGGTCAACAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138694
PKHD1 MISSION shRNA shRNA Plasmid DNA
polycystic kidney and hepatic disease 1 (autosomal recessive)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-9767s1c1
Sequence:CCGGGCGTGGAGATAGAGAACATTACTCGAGTAATGTTCTCTATCTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-2369s1c1
Sequence:CCGGGCCTGTTCTATGTGGATGAAACTCGAGTTTCATCCACATAGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-685s1c1
Sequence:CCGGCCCATCGTTCACCAAGTTTATCTCGAGATAAACTTGGTGAACGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-10843s1c1
Sequence:CCGGGCTTCCTTATTGCTGAATGAACTCGAGTTCATTCAGCAATAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-5179s1c1
Sequence:CCGGGCCCTGGAAATAGAGGTAGATCTCGAGATCTACCTCTATTTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138694.3-3409s21c1
Sequence:CCGGGAAGGTGTTAGCCTGATATTACTCGAGTAATATCAGGCTAACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138694.3-9126s21c1
Sequence:CCGGTGGACTGTTGACCCGAAATATCTCGAGATATTTCGGGTCAACAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138694
PKHD1 MISSION shRNA Lentiviral Transduction Particles
polycystic kidney and hepatic disease 1 (autosomal recessive)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-9767s1c1
Sequence:CCGGGCGTGGAGATAGAGAACATTACTCGAGTAATGTTCTCTATCTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-2369s1c1
Sequence:CCGGGCCTGTTCTATGTGGATGAAACTCGAGTTTCATCCACATAGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-685s1c1
Sequence:CCGGCCCATCGTTCACCAAGTTTATCTCGAGATAAACTTGGTGAACGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-10843s1c1
Sequence:CCGGGCTTCCTTATTGCTGAATGAACTCGAGTTCATTCAGCAATAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138694.2-5179s1c1
Sequence:CCGGGCCCTGGAAATAGAGGTAGATCTCGAGATCTACCTCTATTTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138694.3-3409s21c1
Sequence:CCGGGAAGGTGTTAGCCTGATATTACTCGAGTAATATCAGGCTAACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138694.3-9126s21c1
Sequence:CCGGTGGACTGTTGACCCGAAATATCTCGAGATATTTCGGGTCAACAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks