EMAIL THIS PAGE TO A FRIEND

PKIA

protein kinase (cAMP-dependent, catalytic) inhibitor alpha

Synonyms: PRKACN1
UniProtKB ID: P61925, P04541, Q6IAV2
Gene ID:
Human(5569) Summary: The protein encoded by this gene is a member of the cAMP-dependent protein kinase (PKA) inhibitor family. This protein was demonstrated to interact with and inhibit the activities of both C alpha and C beta catalytic subunits of the PKA. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Mouse(18767) protein kinase inhibitor, alpha
Rat(114906) protein kinase (cAMP-dependent, catalytic) inhibitor alpha
chicken(396333) protein kinase (cAMP-dependent, catalytic) inhibitor alpha
dog(610744) protein kinase (cAMP-dependent, catalytic) inhibitor alpha
domestic cat(101084166) protein kinase (cAMP-dependent, catalytic) inhibitor alpha
cow(613524) protein kinase (cAMP-dependent, catalytic) inhibitor alpha
sheep(101110769) protein kinase (cAMP-dependent, catalytic) inhibitor alpha
naked mole-rat(101714948) protein kinase (cAMP-dependent, catalytic) inhibitor alpha
domestic guinea pig(100734968) protein kinase (cAMP-dependent, catalytic) inhibitor alpha
182 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006823 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047051 MISSION® esiRNA esiRNA human PKIA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006823 Rosetta Predictions human pricing
NM_181839 Rosetta Predictions human pricing
NM_053772 Rosetta Predictions rat pricing
NM_008862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234568 predicted 1214
2 SASI_Hs01_00234569 predicted 799
3 SASI_Hs01_00234570 predicted 1042
4 SASI_Hs01_00234571 predicted 1006
5 SASI_Hs01_00234573 predicted 1175
6 SASI_Hs01_00234574 predicted 996
7 SASI_Hs01_00234575 predicted 1088
8 SASI_Hs02_00342376 predicted 1223
9 SASI_Hs01_00234576 predicted 1077
10 SASI_Hs01_00234577 predicted 968
11 SASI_Hs01_00234572 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163866 predicted 1082
2 SASI_Hs01_00163867 predicted 673
3 SASI_Hs01_00163868 predicted 916
4 SASI_Hs01_00163869 predicted 876
5 SASI_Hs01_00163871 predicted 1045
6 SASI_Hs01_00163872 predicted 868
7 SASI_Hs01_00163873 predicted 957
8 SASI_Hs02_00370429 predicted 1098
9 SASI_Hs01_00163874 predicted 948
10 SASI_Hs01_00163875 predicted 831
11 SASI_Hs01_00163870 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266571 predicted 330
2 SASI_Rn01_00092465 predicted 712
3 SASI_Rn01_00092466 predicted 680
4 SASI_Rn01_00092467 predicted 474
5 SASI_Rn01_00092468 predicted 303
6 SASI_Rn01_00092470 predicted 315
7 SASI_Rn01_00092471 predicted 217
8 SASI_Rn01_00092472 predicted 747
9 SASI_Rn01_00092473 predicted 523
10 SASI_Rn01_00092474 predicted 749
11 SASI_Rn01_00092469 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154728 predicted 589
2 SASI_Mm01_00154729 predicted 658
3 SASI_Mm02_00314814 predicted 228
4 SASI_Mm01_00154731 predicted 276
5 SASI_Mm02_00314815 predicted 738
6 SASI_Mm02_00314816 predicted 840
7 SASI_Mm02_00314817 predicted 277
8 SASI_Mm01_00154735 predicted 421
9 SASI_Mm02_00314818 predicted 785
10 SASI_Mm02_00314819 predicted 586
11 SASI_Mm01_00154727 predicted 770
12 SASI_Mm01_00154730 predicted 585
13 SASI_Mm01_00154732 predicted 208
14 SASI_Mm01_00154733 predicted 327
15 SASI_Mm01_00154734 predicted 798
16 SASI_Mm01_00154736 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006823
VALIDATED
PKIA MISSION shRNA Bacterial Glycerol Stock
protein kinase (cAMP-dependent, catalytic) inhibitor alpha
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006823.x-681s1c1
Sequence:CCGGGAAGAAGATGCACAACGAAGTCTCGAGACTTCGTTGTGCATCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_006823.x-615s1c1
Sequence:CCGGGCAAGTGGCAACAGCAATGAACTCGAGTTCATTGCTGTTGCCACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006823.x-643s1c1
Sequence:CCGGTGAAATTAGCAGGTCTTGATACTCGAGTATCAAGACCTGCTAATTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_006823.x-616s1c1
Sequence:CCGGCAAGTGGCAACAGCAATGAATCTCGAGATTCATTGCTGTTGCCACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006823.x-1042s1c1
Sequence:CCGGGCTCCGACCTAGATGATGATTCTCGAGAATCATCATCTAGGTCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006823.2-695s21c1
Sequence:CCGGACGAAGTTCTACAGAACAAAGCTCGAGCTTTGTTCTGTAGAACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006823.2-1111s21c1
Sequence:CCGGCTAATTGCGAAGGGTTGATTGCTCGAGCAATCAACCCTTCGCAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006823.2-644s21c1
Sequence:CCGGGAAATTAGCAGGTCTTGATATCTCGAGATATCAAGACCTGCTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006823.2-971s21c1
Sequence:CCGGGCTTGTGTTTGGGCGTCATTTCTCGAGAAATGACGCCCAAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006823.2-582s21c1
Sequence:CCGGAGAAATGCAATACATGATATCCTCGAGGATATCATGTATTGCATTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006823.2-628s21c1
Sequence:CCGGGCAATGAATTAGCCTTGAAATCTCGAGATTTCAAGGCTAATTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006823
VALIDATED
PKIA MISSION shRNA shRNA Plasmid DNA
protein kinase (cAMP-dependent, catalytic) inhibitor alpha
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006823.x-681s1c1
Sequence:CCGGGAAGAAGATGCACAACGAAGTCTCGAGACTTCGTTGTGCATCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_006823.x-615s1c1
Sequence:CCGGGCAAGTGGCAACAGCAATGAACTCGAGTTCATTGCTGTTGCCACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006823.x-643s1c1
Sequence:CCGGTGAAATTAGCAGGTCTTGATACTCGAGTATCAAGACCTGCTAATTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_006823.x-616s1c1
Sequence:CCGGCAAGTGGCAACAGCAATGAATCTCGAGATTCATTGCTGTTGCCACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006823.x-1042s1c1
Sequence:CCGGGCTCCGACCTAGATGATGATTCTCGAGAATCATCATCTAGGTCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006823.2-695s21c1
Sequence:CCGGACGAAGTTCTACAGAACAAAGCTCGAGCTTTGTTCTGTAGAACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006823.2-1111s21c1
Sequence:CCGGCTAATTGCGAAGGGTTGATTGCTCGAGCAATCAACCCTTCGCAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006823.2-644s21c1
Sequence:CCGGGAAATTAGCAGGTCTTGATATCTCGAGATATCAAGACCTGCTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006823.2-971s21c1
Sequence:CCGGGCTTGTGTTTGGGCGTCATTTCTCGAGAAATGACGCCCAAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006823.2-582s21c1
Sequence:CCGGAGAAATGCAATACATGATATCCTCGAGGATATCATGTATTGCATTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006823.2-628s21c1
Sequence:CCGGGCAATGAATTAGCCTTGAAATCTCGAGATTTCAAGGCTAATTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006823
VALIDATED
PKIA MISSION shRNA Lentiviral Transduction Particles
protein kinase (cAMP-dependent, catalytic) inhibitor alpha
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006823.x-681s1c1
Sequence:CCGGGAAGAAGATGCACAACGAAGTCTCGAGACTTCGTTGTGCATCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_006823.x-615s1c1
Sequence:CCGGGCAAGTGGCAACAGCAATGAACTCGAGTTCATTGCTGTTGCCACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006823.x-643s1c1
Sequence:CCGGTGAAATTAGCAGGTCTTGATACTCGAGTATCAAGACCTGCTAATTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_006823.x-616s1c1
Sequence:CCGGCAAGTGGCAACAGCAATGAATCTCGAGATTCATTGCTGTTGCCACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006823.x-1042s1c1
Sequence:CCGGGCTCCGACCTAGATGATGATTCTCGAGAATCATCATCTAGGTCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006823.2-695s21c1
Sequence:CCGGACGAAGTTCTACAGAACAAAGCTCGAGCTTTGTTCTGTAGAACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006823.2-1111s21c1
Sequence:CCGGCTAATTGCGAAGGGTTGATTGCTCGAGCAATCAACCCTTCGCAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006823.2-644s21c1
Sequence:CCGGGAAATTAGCAGGTCTTGATATCTCGAGATATCAAGACCTGCTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006823.2-971s21c1
Sequence:CCGGGCTTGTGTTTGGGCGTCATTTCTCGAGAAATGACGCCCAAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006823.2-582s21c1
Sequence:CCGGAGAAATGCAATACATGATATCCTCGAGGATATCATGTATTGCATTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006823.2-628s21c1
Sequence:CCGGGCAATGAATTAGCCTTGAAATCTCGAGATTTCAAGGCTAATTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008862
VALIDATED
PKIA MISSION shRNA Bacterial Glycerol Stock
protein kinase (cAMP-dependent, catalytic) inhibitor alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008862.2-1405s1c1
Sequence:CCGGGCCCTTTCATACCCAAATGTTCTCGAGAACATTTGGGTATGAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008862.2-212s1c1
Sequence:CCGGCAGCAATGAATTAGCCTTAAACTCGAGTTTAAGGCTAATTCATTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008862.2-288s1c1
Sequence:CCGGTCCACCGAACAAAGTGGAGAACTCGAGTTCTCCACTTTGTTCGGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008862.2-157s1c1
Sequence:CCGGGAACAGGTAGAAGAAATGCAACTCGAGTTGCATTTCTTCTACCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008862.2-174s1c1
Sequence:CCGGGCAATACATGATATCCTGGTTCTCGAGAACCAGGATATCATGTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008862.3-223s21c1
Sequence:CCGGGAACAGGTAGAAGAAATGCAACTCGAGTTGCATTTCTTCTACCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008862.3-383s21c1
Sequence:CCGGAGAAGCAGCCAAGTCTGAAAGCTCGAGCTTTCAGACTTGGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008862.3-270s21c1
Sequence:CCGGAGTGGCAACAGCAATGAATTACTCGAGTAATTCATTGCTGTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008862.3-346s21c1
Sequence:CCGGAGAGAAGCTCCACCGAACAAACTCGAGTTTGTTCGGTGGAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008862.3-1471s21c1
Sequence:CCGGGCCCTTTCATACCCAAATGTTCTCGAGAACATTTGGGTATGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008862
VALIDATED
PKIA MISSION shRNA shRNA Plasmid DNA
protein kinase (cAMP-dependent, catalytic) inhibitor alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008862.2-1405s1c1
Sequence:CCGGGCCCTTTCATACCCAAATGTTCTCGAGAACATTTGGGTATGAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008862.2-212s1c1
Sequence:CCGGCAGCAATGAATTAGCCTTAAACTCGAGTTTAAGGCTAATTCATTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008862.2-288s1c1
Sequence:CCGGTCCACCGAACAAAGTGGAGAACTCGAGTTCTCCACTTTGTTCGGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008862.2-157s1c1
Sequence:CCGGGAACAGGTAGAAGAAATGCAACTCGAGTTGCATTTCTTCTACCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008862.2-174s1c1
Sequence:CCGGGCAATACATGATATCCTGGTTCTCGAGAACCAGGATATCATGTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008862.3-223s21c1
Sequence:CCGGGAACAGGTAGAAGAAATGCAACTCGAGTTGCATTTCTTCTACCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008862.3-383s21c1
Sequence:CCGGAGAAGCAGCCAAGTCTGAAAGCTCGAGCTTTCAGACTTGGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008862.3-270s21c1
Sequence:CCGGAGTGGCAACAGCAATGAATTACTCGAGTAATTCATTGCTGTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008862.3-346s21c1
Sequence:CCGGAGAGAAGCTCCACCGAACAAACTCGAGTTTGTTCGGTGGAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008862.3-1471s21c1
Sequence:CCGGGCCCTTTCATACCCAAATGTTCTCGAGAACATTTGGGTATGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008862
VALIDATED
PKIA MISSION shRNA Lentiviral Transduction Particles
protein kinase (cAMP-dependent, catalytic) inhibitor alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008862.2-1405s1c1
Sequence:CCGGGCCCTTTCATACCCAAATGTTCTCGAGAACATTTGGGTATGAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008862.2-212s1c1
Sequence:CCGGCAGCAATGAATTAGCCTTAAACTCGAGTTTAAGGCTAATTCATTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008862.2-288s1c1
Sequence:CCGGTCCACCGAACAAAGTGGAGAACTCGAGTTCTCCACTTTGTTCGGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008862.2-157s1c1
Sequence:CCGGGAACAGGTAGAAGAAATGCAACTCGAGTTGCATTTCTTCTACCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008862.2-174s1c1
Sequence:CCGGGCAATACATGATATCCTGGTTCTCGAGAACCAGGATATCATGTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008862.3-223s21c1
Sequence:CCGGGAACAGGTAGAAGAAATGCAACTCGAGTTGCATTTCTTCTACCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008862.3-383s21c1
Sequence:CCGGAGAAGCAGCCAAGTCTGAAAGCTCGAGCTTTCAGACTTGGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008862.3-270s21c1
Sequence:CCGGAGTGGCAACAGCAATGAATTACTCGAGTAATTCATTGCTGTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008862.3-346s21c1
Sequence:CCGGAGAGAAGCTCCACCGAACAAACTCGAGTTTGTTCGGTGGAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008862.3-1471s21c1
Sequence:CCGGGCCCTTTCATACCCAAATGTTCTCGAGAACATTTGGGTATGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks