EMAIL THIS PAGE TO A FRIEND

PLA2G2A

phospholipase A2, group IIA (platelets, synovial fluid)

Synonyms: MOM1 PLA2 PLA2B PLA2L PLA2S PLAS1 sPLA2
UniProtKB ID: P14555, A8K5I7, Q6DN24, Q6IBD9, Q9UCD2
Gene ID:
Human(5320) Summary: The protein encoded by this gene is a member of the phospholipase A2 family (PLA2). PLA2s constitute a diverse family of enzymes with respect to sequence, function, localization, and divalent cation requirements. This gene product belongs to group II, which contains secreted form of PLA2, an extracellular enzyme that has a low molecular mass and requires calcium ions for catalysis. It catalyzes the hydrolysis of the sn-2 fatty acid acyl ester bond of phosphoglycerides, releasing free fatty acids and lysophospholipids, and thought to participate in the regulation of the phospholipid metabolism in biomembranes. Several alternatively spliced transcript variants with different 5' UTRs have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(18780) phospholipase A2, group IIA (platelets, synovial fluid)
Rat(29692) phospholipase A2, group IIA (platelets, synovial fluid)
chicken(426748) phospholipase A2, group IIA (platelets, synovial fluid)
domestic guinea pig(100135599) phospholipase A2, group IIA (platelets, synovial fluid)
cow(507201) phospholipase A2, group IIA (platelets, synovial fluid)
cow(521383) phospholipase A2, group IIA (platelets, synovial fluid)
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
L0420 Anti-PLA2G2A (130-143) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
17970 2,4′-Dibromoacetophenone puriss., ≥98.5% (HPLC) human, rat pricing
D38308 2,4′-Dibromoacetophenone >98% human, rat pricing
594687 α-Sexithiophene human, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB1637 Human PLA2G2A ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000300 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011108 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011108 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011108 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000300 Rosetta Predictions human pricing
NM_031598 Rosetta Predictions rat pricing
NM_001082531 Rosetta Predictions mouse pricing
NR_002926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142980 predicted 273
2 SASI_Hs01_00142981 predicted 628
3 SASI_Hs02_00302284 predicted 323
4 SASI_Hs01_00142982 predicted 453
5 SASI_Hs01_00142983 predicted 513
6 SASI_Hs01_00142984 predicted 651
7 SASI_Hs01_00142985 predicted 507
8 SASI_Hs01_00142986 predicted 586
9 SASI_Hs02_00302285 predicted 404
10 SASI_Hs01_00142988 predicted 498
11 SASI_Hs01_00142987 predicted 286
12 SASI_Hs01_00142989 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264871 predicted 383
2 SASI_Rn02_00264872 predicted 372
3 SASI_Rn01_00039556 predicted 514
4 SASI_Rn01_00039557 predicted 333
5 SASI_Rn01_00039559 predicted 332
6 SASI_Rn02_00264873 predicted 429
7 SASI_Rn02_00264874 predicted 430
8 SASI_Rn02_00264875 predicted 478
9 SASI_Rn02_00264876 predicted 491
10 SASI_Rn02_00264877 predicted 384
11 SASI_Rn01_00039553 predicted 618
12 SASI_Rn01_00039554 predicted 976
13 SASI_Rn01_00039555 predicted 672
14 SASI_Rn01_00039558 predicted 790
15 SASI_Rn01_00039560 predicted 578
16 SASI_Rn01_00039561 predicted 567
17 SASI_Rn01_00039562 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299282 predicted 535
2 SASI_Mm02_00299283 predicted 491
3 SASI_Mm02_00299284 predicted 311
4 SASI_Mm02_00299285 predicted 366
5 SASI_Mm02_00299286 predicted 269
6 SASI_Mm02_00299287 predicted 407
7 SASI_Mm02_00299288 predicted 220
8 SASI_Mm02_00299289 predicted 277
9 SASI_Mm02_00299290 predicted 407
10 SASI_Mm02_00299291 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353083 predicted 550
2 SASI_Mm02_00353084 predicted 239
3 SASI_Mm02_00353085 predicted 512
4 SASI_Mm02_00353086 predicted 334
5 SASI_Mm02_00353087 predicted 387
6 SASI_Mm02_00353088 predicted 297
7 SASI_Mm02_00353089 predicted 431
8 SASI_Mm02_00353090 predicted 296
9 SASI_Mm02_00353091 predicted 433
10 SASI_Mm02_00353092 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000300
PLA2G2A MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IIA (platelets, synovial fluid)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-383s1c1
Sequence:CCGGCGCACTCAGTTATGGCTTCTACTCGAGTAGAAGCCATAACTGAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-460s1c1
Sequence:CCGGGCTGTGTCACTCATGACTGTTCTCGAGAACAGTCATGAGTGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-356s1c1
Sequence:CCGGGATCAAGTTGACGACAGGAAACTCGAGTTTCCTGTCGTCAACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-325s1c1
Sequence:CCGGCCCATGGGAATTTGGTGAATTCTCGAGAATTCACCAAATTCCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-626s1c1
Sequence:CCGGTGCTAGAAACAAGACGACCTACTCGAGTAGGTCGTCTTGTTTCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000300
PLA2G2A MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IIA (platelets, synovial fluid)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-383s1c1
Sequence:CCGGCGCACTCAGTTATGGCTTCTACTCGAGTAGAAGCCATAACTGAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-460s1c1
Sequence:CCGGGCTGTGTCACTCATGACTGTTCTCGAGAACAGTCATGAGTGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-356s1c1
Sequence:CCGGGATCAAGTTGACGACAGGAAACTCGAGTTTCCTGTCGTCAACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-325s1c1
Sequence:CCGGCCCATGGGAATTTGGTGAATTCTCGAGAATTCACCAAATTCCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-626s1c1
Sequence:CCGGTGCTAGAAACAAGACGACCTACTCGAGTAGGTCGTCTTGTTTCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000300
PLA2G2A MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IIA (platelets, synovial fluid)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-383s1c1
Sequence:CCGGCGCACTCAGTTATGGCTTCTACTCGAGTAGAAGCCATAACTGAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-460s1c1
Sequence:CCGGGCTGTGTCACTCATGACTGTTCTCGAGAACAGTCATGAGTGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-356s1c1
Sequence:CCGGGATCAAGTTGACGACAGGAAACTCGAGTTTCCTGTCGTCAACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-325s1c1
Sequence:CCGGCCCATGGGAATTTGGTGAATTCTCGAGAATTCACCAAATTCCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000300.2-626s1c1
Sequence:CCGGTGCTAGAAACAAGACGACCTACTCGAGTAGGTCGTCTTGTTTCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011108
PLA2G2A MISSION shRNA Bacterial Glycerol Stock
phospholipase A2, group IIA (platelets, synovial fluid)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011108.1-293s1c1
Sequence:CCGGCCAAATCACCTGTTCTGCAAACTCGAGTTTGCAGAACAGGTGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011108.1-125s1c1
Sequence:CCGGGAGCTTAGCTATGCCTTCTATCTCGAGATAGAAGGCATAGCTAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011108.1-67s1c1
Sequence:CCGGCCAAGGGAACATTGCGCAGTTCTCGAGAACTGCGCAATGTTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011108.1-49s1c1
Sequence:CCGGCTTTGGCTCAATACAGGTCCACTCGAGTGGACCTGTATTGAGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011108.1-111s1c1
Sequence:CCGGCAGGAAAGAGAGCTGAGCTTACTCGAGTAAGCTCAGCTCTCTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011108
PLA2G2A MISSION shRNA shRNA Plasmid DNA
phospholipase A2, group IIA (platelets, synovial fluid)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011108.1-293s1c1
Sequence:CCGGCCAAATCACCTGTTCTGCAAACTCGAGTTTGCAGAACAGGTGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011108.1-125s1c1
Sequence:CCGGGAGCTTAGCTATGCCTTCTATCTCGAGATAGAAGGCATAGCTAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011108.1-67s1c1
Sequence:CCGGCCAAGGGAACATTGCGCAGTTCTCGAGAACTGCGCAATGTTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011108.1-49s1c1
Sequence:CCGGCTTTGGCTCAATACAGGTCCACTCGAGTGGACCTGTATTGAGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011108.1-111s1c1
Sequence:CCGGCAGGAAAGAGAGCTGAGCTTACTCGAGTAAGCTCAGCTCTCTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011108
PLA2G2A MISSION shRNA Lentiviral Transduction Particles
phospholipase A2, group IIA (platelets, synovial fluid)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011108.1-293s1c1
Sequence:CCGGCCAAATCACCTGTTCTGCAAACTCGAGTTTGCAGAACAGGTGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011108.1-125s1c1
Sequence:CCGGGAGCTTAGCTATGCCTTCTATCTCGAGATAGAAGGCATAGCTAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011108.1-67s1c1
Sequence:CCGGCCAAGGGAACATTGCGCAGTTCTCGAGAACTGCGCAATGTTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011108.1-49s1c1
Sequence:CCGGCTTTGGCTCAATACAGGTCCACTCGAGTGGACCTGTATTGAGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011108.1-111s1c1
Sequence:CCGGCAGGAAAGAGAGCTGAGCTTACTCGAGTAAGCTCAGCTCTCTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks