EMAIL THIS PAGE TO A FRIEND

PLAC1L

placenta-specific 1-like

Synonyms: TMEM122
UniProtKB ID: Q86WS3, Q8N9U6
Gene ID:
Mouse(225922) placenta-specific 1-like
Rat(690888) placenta-specific 1-like
domestic cat(101099904) placenta-specific 1-like
domestic guinea pig(100714740) placenta-specific 1-like
naked mole-rat(101716258) placenta-specific 1-like
cow(101903724) placenta-specific 1-like
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173801 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008111 MISSION® esiRNA esiRNA targeting human PLAC1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173801 Rosetta Predictions human pricing
XM_001076035 Rosetta Predictions rat pricing
NM_001037634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235226 predicted 509
2 SASI_Hs01_00235228 predicted 638
3 SASI_Hs01_00235229 predicted 279
4 SASI_Hs01_00235231 predicted 738
5 SASI_Hs01_00235233 predicted 681
6 SASI_Hs01_00235234 predicted 756
7 SASI_Hs02_00368657 predicted 510
8 SASI_Hs02_00368658 predicted 622
9 SASI_Hs02_00368659 predicted 494
10 SASI_Hs02_00368660 predicted 502
11 SASI_Hs01_00235227 predicted 303
12 SASI_Hs01_00235230 predicted 666
13 SASI_Hs01_00235232 predicted 620
14 SASI_Hs01_00235235 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351863 predicted 199
2 SASI_Rn02_00351864 predicted 310
3 SASI_Rn02_00351865 predicted 216
4 SASI_Rn02_00351866 predicted 328
5 SASI_Rn02_00351867 predicted 206
6 SASI_Rn02_00351868 predicted 296
7 SASI_Rn02_00351869 predicted 195
8 SASI_Rn02_00351870 predicted 341
9 SASI_Rn02_00351871 predicted 240
10 SASI_Rn02_00351872 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079962 predicted 269
2 SASI_Mm01_00079963 predicted 335
3 SASI_Mm01_00079964 predicted 366
4 SASI_Mm02_00289309 predicted 213
5 SASI_Mm02_00289310 predicted 273
6 SASI_Mm02_00289311 predicted 336
7 SASI_Mm02_00289312 predicted 272
8 SASI_Mm02_00289313 predicted 232
9 SASI_Mm01_00079965 predicted 230
10 SASI_Mm02_00289314 predicted 206
11 SASI_Mm01_00079959 predicted 236
12 SASI_Mm01_00079960 predicted 284
13 SASI_Mm01_00079961 predicted 234
14 SASI_Mm01_00079966 predicted 223
15 SASI_Mm01_00079967 predicted 215
16 SASI_Mm01_00079968 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037634
PLAC1L MISSION shRNA Bacterial Glycerol Stock
placenta-specific 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-85s21c1
Sequence:CCGGGGACTTGTGCTTGGGACATTGCTCGAGCAATGTCCCAAGCACAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-331s21c1
Sequence:CCGGACTTTCGTCCAAGGAATTATTCTCGAGAATAATTCCTTGGACGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-440s21c1
Sequence:CCGGACCTGTTAAGAGTCCCTTTATCTCGAGATAAAGGGACTCTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-282s21c1
Sequence:CCGGAGGACAAAGGTTATCTCAAATCTCGAGATTTGAGATAACCTTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-214s21c1
Sequence:CCGGACTGCCGTGTAACTCAAATACCTCGAGGTATTTGAGTTACACGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037634
PLAC1L MISSION shRNA shRNA Plasmid DNA
placenta-specific 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-85s21c1
Sequence:CCGGGGACTTGTGCTTGGGACATTGCTCGAGCAATGTCCCAAGCACAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-331s21c1
Sequence:CCGGACTTTCGTCCAAGGAATTATTCTCGAGAATAATTCCTTGGACGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-440s21c1
Sequence:CCGGACCTGTTAAGAGTCCCTTTATCTCGAGATAAAGGGACTCTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-282s21c1
Sequence:CCGGAGGACAAAGGTTATCTCAAATCTCGAGATTTGAGATAACCTTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-214s21c1
Sequence:CCGGACTGCCGTGTAACTCAAATACCTCGAGGTATTTGAGTTACACGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037634
PLAC1L MISSION shRNA Lentiviral Transduction Particles
placenta-specific 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-85s21c1
Sequence:CCGGGGACTTGTGCTTGGGACATTGCTCGAGCAATGTCCCAAGCACAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-331s21c1
Sequence:CCGGACTTTCGTCCAAGGAATTATTCTCGAGAATAATTCCTTGGACGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-440s21c1
Sequence:CCGGACCTGTTAAGAGTCCCTTTATCTCGAGATAAAGGGACTCTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-282s21c1
Sequence:CCGGAGGACAAAGGTTATCTCAAATCTCGAGATTTGAGATAACCTTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037634.3-214s21c1
Sequence:CCGGACTGCCGTGTAACTCAAATACCTCGAGGTATTTGAGTTACACGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173801
PLAC1L MISSION shRNA Bacterial Glycerol Stock
placenta-specific 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173801.3-328s1c1
Sequence:CCGGCGGATGAATTACATCTGGGAACTCGAGTTCCCAGATGTAATTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173801.3-538s1c1
Sequence:CCGGCAGTGTGGCTTACACCAGTTTCTCGAGAAACTGGTGTAAGCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173801.3-355s1c1
Sequence:CCGGGCCCTGCAAATCGGATACATACTCGAGTATGTATCCGATTTGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173801.3-476s1c1
Sequence:CCGGCCCAAGGAATATAGATCATGACTCGAGTCATGATCTATATTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173801.3-802s1c1
Sequence:CCGGCCTGATTAGTTGATTAGTGAACTCGAGTTCACTAATCAACTAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173801
PLAC1L MISSION shRNA shRNA Plasmid DNA
placenta-specific 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173801.3-328s1c1
Sequence:CCGGCGGATGAATTACATCTGGGAACTCGAGTTCCCAGATGTAATTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173801.3-538s1c1
Sequence:CCGGCAGTGTGGCTTACACCAGTTTCTCGAGAAACTGGTGTAAGCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173801.3-355s1c1
Sequence:CCGGGCCCTGCAAATCGGATACATACTCGAGTATGTATCCGATTTGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173801.3-476s1c1
Sequence:CCGGCCCAAGGAATATAGATCATGACTCGAGTCATGATCTATATTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173801.3-802s1c1
Sequence:CCGGCCTGATTAGTTGATTAGTGAACTCGAGTTCACTAATCAACTAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173801
PLAC1L MISSION shRNA Lentiviral Transduction Particles
placenta-specific 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173801.3-328s1c1
Sequence:CCGGCGGATGAATTACATCTGGGAACTCGAGTTCCCAGATGTAATTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173801.3-538s1c1
Sequence:CCGGCAGTGTGGCTTACACCAGTTTCTCGAGAAACTGGTGTAAGCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173801.3-355s1c1
Sequence:CCGGGCCCTGCAAATCGGATACATACTCGAGTATGTATCCGATTTGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173801.3-476s1c1
Sequence:CCGGCCCAAGGAATATAGATCATGACTCGAGTCATGATCTATATTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173801.3-802s1c1
Sequence:CCGGCCTGATTAGTTGATTAGTGAACTCGAGTTCACTAATCAACTAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks