EMAIL THIS PAGE TO A FRIEND

PLB1

phospholipase B1

Synonyms: PLB PLB/LIP hPLB
UniProtKB ID: Q6P1J6, A8KAX2, Q53S03, Q8IUP7, Q96DP9
Gene ID:
Mouse(665270) phospholipase B1
Rat(192259) phospholipase B1
naked mole-rat(101699397) phospholipase B1
Domestic Rabbit(100009309) phospholipase B1
cow(506508) phospholipase B1
sheep(101113054) phospholipase B1
chicken(771916) phospholipase B1
domestic cat(101089599) phospholipase B1
Horse(100071076) phospholipase B1
dog(611194) phospholipase B1
233 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153021 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153021 Rosetta Predictions human pricing
NM_138898 Rosetta Predictions rat pricing
NM_001081407 Rosetta Predictions mouse pricing
NM_030072 Rosetta Predictions mouse pricing
NM_172147 Rosetta Predictions mouse pricing
XM_979248 Rosetta Predictions mouse pricing
XM_979293 Rosetta Predictions mouse pricing
XM_979329 Rosetta Predictions mouse pricing
XM_979381 Rosetta Predictions mouse pricing
XM_979420 Rosetta Predictions mouse pricing
XM_979459 Rosetta Predictions mouse pricing
XM_979500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097928 predicted 1032
2 SASI_Hs01_00097929 predicted 2353
3 SASI_Hs01_00097930 predicted 460
4 SASI_Hs01_00097932 predicted 1096
5 SASI_Hs01_00097933 predicted 2354
6 SASI_Hs02_00366975 predicted 497
7 SASI_Hs01_00097934 predicted 1747
8 SASI_Hs01_00097935 predicted 1827
9 SASI_Hs01_00097936 predicted 3490
10 SASI_Hs01_00097937 predicted 1511
11 SASI_Hs01_00097931 predicted 2435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094601 predicted 1554
2 SASI_Rn01_00094603 predicted 3205
3 SASI_Rn02_00268350 predicted 992
4 SASI_Rn01_00094606 predicted 2908
5 SASI_Rn01_00094607 predicted 3120
6 SASI_Rn01_00094608 predicted 1595
7 SASI_Rn02_00268351 predicted 3521
8 SASI_Rn02_00268352 predicted 467
9 SASI_Rn01_00094609 predicted 3213
10 SASI_Rn02_00268353 predicted 402
11 SASI_Rn01_00094602 predicted 1370
12 SASI_Rn01_00094604 predicted 2407
13 SASI_Rn01_00094605 predicted 2429
14 SASI_Rn01_00094610 predicted 2766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298081 predicted 4432
2 SASI_Mm02_00298082 predicted 4386
3 SASI_Mm02_00298083 predicted 4388
4 SASI_Mm02_00298084 predicted 4370
5 SASI_Mm02_00298085 predicted 4389
6 SASI_Mm02_00298086 predicted 4386
7 SASI_Mm02_00298087 predicted 4363
8 SASI_Mm02_00298088 predicted 4416
9 SASI_Mm02_00298089 predicted 4428
10 SASI_Mm02_00298090 predicted 4372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336458 predicted 1749
2 SASI_Mm02_00336459 predicted 790
3 SASI_Mm02_00336460 predicted 353
4 SASI_Mm02_00336461 predicted 2560
5 SASI_Mm02_00336462 predicted 1742
6 SASI_Mm02_00336463 predicted 1879
7 SASI_Mm02_00336464 predicted 965
8 SASI_Mm02_00336465 predicted 2387
9 SASI_Mm02_00336466 predicted 2064
10 SASI_Mm02_00336467 predicted 2546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343687 predicted 339
2 SASI_Mm02_00343688 predicted 299
3 SASI_Mm02_00343689 predicted 296
4 SASI_Mm02_00343690 predicted 286
5 SASI_Mm02_00343691 predicted 298
6 SASI_Mm02_00343692 predicted 297
7 SASI_Mm02_00343693 predicted 272
8 SASI_Mm02_00343694 predicted 322
9 SASI_Mm02_00343695 predicted 339
10 SASI_Mm02_00343696 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227741 predicted 1759
2 SASI_Mm01_00227742 predicted 790
3 SASI_Mm01_00227743 predicted 364
4 SASI_Mm01_00227744 predicted 2562
5 SASI_Mm01_00227745 predicted 1746
6 SASI_Mm01_00227746 predicted 1878
7 SASI_Mm01_00227747 predicted 974
8 SASI_Mm01_00227748 predicted 1271
9 SASI_Mm01_00227749 predicted 2399
10 SASI_Mm01_00227750 predicted 2073
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223601 predicted 1248
2 SASI_Mm01_00223602 predicted 991
3 SASI_Mm01_00223603 predicted 566
4 SASI_Mm01_00223604 predicted 1168
5 SASI_Mm01_00223605 predicted 914
6 SASI_Mm01_00223606 predicted 553
7 SASI_Mm01_00223607 predicted 583
8 SASI_Mm01_00223608 predicted 379
9 SASI_Mm01_00223609 predicted 1330
10 SASI_Mm01_00223610 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229671 predicted 2041
2 SASI_Mm01_00229672 predicted 1077
3 SASI_Mm01_00229673 predicted 646
4 SASI_Mm01_00229674 predicted 2025
5 SASI_Mm01_00229675 predicted 2159
6 SASI_Mm01_00229676 predicted 1254
7 SASI_Mm01_00229677 predicted 1546
8 SASI_Mm01_00229678 predicted 2351
9 SASI_Mm01_00229679 predicted 1415
10 SASI_Mm01_00229680 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280827 predicted 4146
2 SASI_Mm01_00280828 predicted 4113
3 SASI_Mm01_00280829 predicted 4111
4 SASI_Mm01_00280830 predicted 4098
5 SASI_Mm01_00280831 predicted 4111
6 SASI_Mm01_00280832 predicted 4115
7 SASI_Mm01_00280833 predicted 4086
8 SASI_Mm01_00280834 predicted 4137
9 SASI_Mm01_00280835 predicted 4154
10 SASI_Mm01_00280836 predicted 4088
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236533 predicted 4438
2 SASI_Mm01_00236534 predicted 4400
3 SASI_Mm01_00236535 predicted 4391
4 SASI_Mm01_00236536 predicted 4376
5 SASI_Mm01_00236537 predicted 4396
6 SASI_Mm01_00236538 predicted 4395
7 SASI_Mm01_00236539 predicted 4369
8 SASI_Mm01_00236540 predicted 4416
9 SASI_Mm01_00236541 predicted 4434
10 SASI_Mm01_00236542 predicted 4377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210628 predicted 4354
2 SASI_Mm01_00210629 predicted 4318
3 SASI_Mm01_00210630 predicted 4312
4 SASI_Mm01_00210631 predicted 4294
5 SASI_Mm01_00210632 predicted 4317
6 SASI_Mm01_00210633 predicted 4318
7 SASI_Mm01_00210634 predicted 4289
8 SASI_Mm01_00210635 predicted 4345
9 SASI_Mm01_00210636 predicted 4351
10 SASI_Mm01_00210637 predicted 4295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265137 predicted 358
2 SASI_Mm01_00265138 predicted 302
3 SASI_Mm01_00265139 predicted 242
4 SASI_Mm01_00265140 predicted 318
5 SASI_Mm01_00265141 predicted 312
6 SASI_Mm01_00265142 predicted 295
7 SASI_Mm01_00265143 predicted 245
8 SASI_Mm01_00265144 predicted 342
9 SASI_Mm01_00265145 predicted 234
10 SASI_Mm01_00265146 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153021
PLB1 MISSION shRNA Bacterial Glycerol Stock
phospholipase B1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-2538s1c1
Sequence:CCGGCCATGAAGACTGGAAGGTCATCTCGAGATGACCTTCCAGTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153021.3-2437s1c1
Sequence:CCGGGCATTCCTCAATCAAGCTGTTCTCGAGAACAGCTTGATTGAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-3679s1c1
Sequence:CCGGGAATATGTTCAGCACATCCAACTCGAGTTGGATGTGCTGAACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153021.3-4540s1c1
Sequence:CCGGGCTCCTGGAATGGATACATTTCTCGAGAAATGTATCCATTCCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153021.3-2362s1c1
Sequence:CCGGCCTAATATCCTTCGGGAGTTTCTCGAGAAACTCCCGAAGGATATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-3036s1c1
Sequence:CCGGCAGAGCCCTTTGGACCAATATCTCGAGATATTGGTCCAAAGGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-418s1c1
Sequence:CCGGGACTTGTGGATTCAGGCTCAACTCGAGTTGAGCCTGAATCCACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-3550s1c1
Sequence:CCGGGACCTGGTAGAGCGAATGAAACTCGAGTTTCATTCGCTCTACCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153021.3-2470s1c1
Sequence:CCGGGCTGAGGATCTTATGAGCCAACTCGAGTTGGCTCATAAGATCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153021.3-2620s1c1
Sequence:CCGGGCAGCCAACTTTGTTGACCATCTCGAGATGGTCAACAAAGTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153021
PLB1 MISSION shRNA shRNA Plasmid DNA
phospholipase B1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-2538s1c1
Sequence:CCGGCCATGAAGACTGGAAGGTCATCTCGAGATGACCTTCCAGTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153021.3-2437s1c1
Sequence:CCGGGCATTCCTCAATCAAGCTGTTCTCGAGAACAGCTTGATTGAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-3679s1c1
Sequence:CCGGGAATATGTTCAGCACATCCAACTCGAGTTGGATGTGCTGAACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153021.3-4540s1c1
Sequence:CCGGGCTCCTGGAATGGATACATTTCTCGAGAAATGTATCCATTCCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153021.3-2362s1c1
Sequence:CCGGCCTAATATCCTTCGGGAGTTTCTCGAGAAACTCCCGAAGGATATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-3036s1c1
Sequence:CCGGCAGAGCCCTTTGGACCAATATCTCGAGATATTGGTCCAAAGGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-418s1c1
Sequence:CCGGGACTTGTGGATTCAGGCTCAACTCGAGTTGAGCCTGAATCCACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-3550s1c1
Sequence:CCGGGACCTGGTAGAGCGAATGAAACTCGAGTTTCATTCGCTCTACCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153021.3-2470s1c1
Sequence:CCGGGCTGAGGATCTTATGAGCCAACTCGAGTTGGCTCATAAGATCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153021.3-2620s1c1
Sequence:CCGGGCAGCCAACTTTGTTGACCATCTCGAGATGGTCAACAAAGTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153021
PLB1 MISSION shRNA Lentiviral Transduction Particles
phospholipase B1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-2538s1c1
Sequence:CCGGCCATGAAGACTGGAAGGTCATCTCGAGATGACCTTCCAGTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153021.3-2437s1c1
Sequence:CCGGGCATTCCTCAATCAAGCTGTTCTCGAGAACAGCTTGATTGAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-3679s1c1
Sequence:CCGGGAATATGTTCAGCACATCCAACTCGAGTTGGATGTGCTGAACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153021.3-4540s1c1
Sequence:CCGGGCTCCTGGAATGGATACATTTCTCGAGAAATGTATCCATTCCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153021.3-2362s1c1
Sequence:CCGGCCTAATATCCTTCGGGAGTTTCTCGAGAAACTCCCGAAGGATATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-3036s1c1
Sequence:CCGGCAGAGCCCTTTGGACCAATATCTCGAGATATTGGTCCAAAGGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-418s1c1
Sequence:CCGGGACTTGTGGATTCAGGCTCAACTCGAGTTGAGCCTGAATCCACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153021.3-3550s1c1
Sequence:CCGGGACCTGGTAGAGCGAATGAAACTCGAGTTTCATTCGCTCTACCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153021.3-2470s1c1
Sequence:CCGGGCTGAGGATCTTATGAGCCAACTCGAGTTGGCTCATAAGATCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153021.3-2620s1c1
Sequence:CCGGGCAGCCAACTTTGTTGACCATCTCGAGATGGTCAACAAAGTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081407
VALIDATED
PLB1 MISSION shRNA Bacterial Glycerol Stock
phospholipase B1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081407.1-3642s21c1
Sequence:CCGGAGCTCGGCCAAGTGGATATAACTCGAGTTATATCCACTTGGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081407.1-3795s21c1
Sequence:CCGGGGACAACAAGGCAGGATTAAACTCGAGTTTAATCCTGCCTTGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081407.1-2677s21c1
Sequence:CCGGCCCAATATCCTACGGAAATTTCTCGAGAAATTTCCGTAGGATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081407.1-3973s21c1
Sequence:CCGGCCGGAGGACAACTCAACTAAACTCGAGTTTAGTTGAGTTGTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081407.1-2162s21c1
Sequence:CCGGGATATGACACGAGGGATAATTCTCGAGAATTATCCCTCGTGTCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081407
VALIDATED
PLB1 MISSION shRNA shRNA Plasmid DNA
phospholipase B1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081407.1-3642s21c1
Sequence:CCGGAGCTCGGCCAAGTGGATATAACTCGAGTTATATCCACTTGGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081407.1-3795s21c1
Sequence:CCGGGGACAACAAGGCAGGATTAAACTCGAGTTTAATCCTGCCTTGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081407.1-2677s21c1
Sequence:CCGGCCCAATATCCTACGGAAATTTCTCGAGAAATTTCCGTAGGATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081407.1-3973s21c1
Sequence:CCGGCCGGAGGACAACTCAACTAAACTCGAGTTTAGTTGAGTTGTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081407.1-2162s21c1
Sequence:CCGGGATATGACACGAGGGATAATTCTCGAGAATTATCCCTCGTGTCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081407
VALIDATED
PLB1 MISSION shRNA Lentiviral Transduction Particles
phospholipase B1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081407.1-3642s21c1
Sequence:CCGGAGCTCGGCCAAGTGGATATAACTCGAGTTATATCCACTTGGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081407.1-3795s21c1
Sequence:CCGGGGACAACAAGGCAGGATTAAACTCGAGTTTAATCCTGCCTTGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081407.1-2677s21c1
Sequence:CCGGCCCAATATCCTACGGAAATTTCTCGAGAAATTTCCGTAGGATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081407.1-3973s21c1
Sequence:CCGGCCGGAGGACAACTCAACTAAACTCGAGTTTAGTTGAGTTGTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081407.1-2162s21c1
Sequence:CCGGGATATGACACGAGGGATAATTCTCGAGAATTATCCCTCGTGTCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks