EMAIL THIS PAGE TO A FRIEND

PLCG1

phospholipase C, gamma 1

Synonyms: NCKAP3 PLC-II PLC1 PLC148 PLCgamma1
UniProtKB ID: P19174, B7ZLY7, B9EGH4, E1P5W4, Q2V575
Gene ID:
Human(5335) Summary: The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18803) phospholipase C, gamma 1
Rat(25738) phospholipase C, gamma 1
Zebrafish(373867) phospholipase C, gamma 1
chicken(419175) phospholipase C, gamma 1
domestic cat(101092925) phospholipase C, gamma 1
dog(485874) phospholipase C, gamma 1
naked mole-rat(101705192) phospholipase C, gamma 1
domestic guinea pig(100716986) phospholipase C, gamma 1
cow(281987) phospholipase C, gamma 1
sheep(101103341) phospholipase C, gamma 1
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503971 Anti-phospho-PLCG1 (pTyr1253) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300271 Anti-phospho-PLCG1 (pTyr771) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, western blot pricing
SAB4503826 Anti-phospho-PLCG1 (pTyr771) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4300082 Anti-phospho-PLCG1 (pTyr783) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4503827 Anti-phospho-PLCG1 (pTyr783) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4300588 Anti-PLCG1 (Ab-771) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4300401 Anti-PLCG1 (Ab-783) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
HPA036681 Anti-PLCG1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA036682 Anti-PLCG1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502204 Anti-PLCG1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4502205 Anti-PLCG1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4502206 Anti-PLCG1, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence pricing
WH0005335M1 Monoclonal Anti-PLCG1 antibody produced in mouse clone 2A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002660 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021280 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021280 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021280 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002660 Rosetta Predictions human pricing
NM_182811 Rosetta Predictions human pricing
NM_013187 Rosetta Predictions rat pricing
NM_021280 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334210 predicted 968
2 SASI_Hs01_00038333 predicted 3089
3 SASI_Hs02_00334211 predicted 736
4 SASI_Hs01_00038335 predicted 615
5 SASI_Hs01_00038337 predicted 1614
6 SASI_Hs01_00038338 predicted 1380
7 SASI_Hs02_00334212 predicted 491
8 SASI_Hs01_00038340 predicted 451
9 SASI_Hs01_00038341 predicted 1569
10 SASI_Hs01_00038342 predicted 1067
11 SASI_Hs01_00038334 predicted 1298
12 SASI_Hs01_00038336 predicted 435
13 SASI_Hs01_00038339 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370956 predicted 972
2 SASI_Hs01_00165454 predicted 3091
3 SASI_Hs02_00370957 predicted 732
4 SASI_Hs01_00165456 predicted 612
5 SASI_Hs01_00165458 predicted 1610
6 SASI_Hs01_00165459 predicted 1383
7 SASI_Hs02_00370958 predicted 488
8 SASI_Hs01_00165461 predicted 455
9 SASI_Hs01_00165462 predicted 1567
10 SASI_Hs01_00165463 predicted 1058
11 SASI_Hs01_00165455 predicted 1290
12 SASI_Hs01_00165457 predicted 435
13 SASI_Hs01_00165460 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088698 predicted 1308
2 SASI_Rn02_00261021 predicted 2538
3 SASI_Rn02_00261022 predicted 706
4 SASI_Rn02_00261023 predicted 3479
5 SASI_Rn01_00088700 predicted 3064
6 SASI_Rn01_00088701 predicted 3728
7 SASI_Rn01_00088703 predicted 3838
8 SASI_Rn01_00088704 predicted 1265
9 SASI_Rn01_00088705 predicted 3514
10 SASI_Rn01_00088706 predicted 501
11 SASI_Rn01_00088699 predicted 2046
12 SASI_Rn01_00088702 predicted 1945
13 SASI_Rn01_00088707 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197033 predicted 1349
2 SASI_Mm01_00197034 predicted 2216
3 SASI_Mm02_00325801 predicted 745
4 SASI_Mm01_00197036 predicted 3880
5 SASI_Mm01_00197037 predicted 1987
6 SASI_Mm02_00325802 predicted 3511
7 SASI_Mm01_00197038 predicted 3768
8 SASI_Mm01_00197039 predicted 3683
9 SASI_Mm01_00197040 predicted 642
10 SASI_Mm02_00325803 predicted 1652
11 SASI_Mm01_00197035 predicted 3104
12 SASI_Mm01_00197041 predicted 539
13 SASI_Mm01_00197042 predicted 2866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002660
VALIDATED
PLCG1 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, gamma 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002660.2-4402s1c1
Sequence:CCGGCCAGGGAAACAAAGTTTACATCTCGAGATGTAAACTTTGTTTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002660.2-1619s1c1
Sequence:CCGGCCTGTGAACCACGAATGGTATCTCGAGATACCATTCGTGGTTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002660.2-3562s1c1
Sequence:CCGGCCAGATCAGTAACCCTGAATTCTCGAGAATTCAGGGTTACTGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002660.2-335s1c1
Sequence:CCGGGCCATTGACATTCGTGAAATTCTCGAGAATTTCACGAATGTCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002660.2-427s1c1
Sequence:CCGGCCAGTCACATTGCTTTGTCATCTCGAGATGACAAAGCAATGTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002660.2-3735s21c1
Sequence:GTACCGGTGCTGATCAAGATTGACATTTCTCGAGAAATGTCAATCTTGATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002660.2-3114s21c1
Sequence:GTACCGGAGAAGTTCCTTCAGTACAATCCTCGAGGATTGTACTGAAGGAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002660.2-4213s21c1
Sequence:CCGGCTGTACTGTGTTTCGCATTAACTCGAGTTAATGCGAAACACAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002660.2-1235s21c1
Sequence:CCGGCCGGATGGGATGCCAGTTATTCTCGAGAATAACTGGCATCCCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002660.2-618s21c1
Sequence:CCGGGGAATCGTGAGGATCGTATATCTCGAGATATACGATCCTCACGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002660.2-335s21c1
Sequence:CCGGGCCATTGACATTCGTGAAATTCTCGAGAATTTCACGAATGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002660.2-2062s21c1
Sequence:GTACCGGTGAGTTTGAGATGCGACTTTCCTCGAGGAAAGTCGCATCTCAAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002660
VALIDATED
PLCG1 MISSION shRNA shRNA Plasmid DNA
phospholipase C, gamma 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002660.2-4402s1c1
Sequence:CCGGCCAGGGAAACAAAGTTTACATCTCGAGATGTAAACTTTGTTTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002660.2-1619s1c1
Sequence:CCGGCCTGTGAACCACGAATGGTATCTCGAGATACCATTCGTGGTTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002660.2-3562s1c1
Sequence:CCGGCCAGATCAGTAACCCTGAATTCTCGAGAATTCAGGGTTACTGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002660.2-335s1c1
Sequence:CCGGGCCATTGACATTCGTGAAATTCTCGAGAATTTCACGAATGTCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002660.2-427s1c1
Sequence:CCGGCCAGTCACATTGCTTTGTCATCTCGAGATGACAAAGCAATGTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002660.2-3735s21c1
Sequence:GTACCGGTGCTGATCAAGATTGACATTTCTCGAGAAATGTCAATCTTGATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002660.2-3114s21c1
Sequence:GTACCGGAGAAGTTCCTTCAGTACAATCCTCGAGGATTGTACTGAAGGAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002660.2-4213s21c1
Sequence:CCGGCTGTACTGTGTTTCGCATTAACTCGAGTTAATGCGAAACACAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002660.2-1235s21c1
Sequence:CCGGCCGGATGGGATGCCAGTTATTCTCGAGAATAACTGGCATCCCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002660.2-618s21c1
Sequence:CCGGGGAATCGTGAGGATCGTATATCTCGAGATATACGATCCTCACGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002660.2-335s21c1
Sequence:CCGGGCCATTGACATTCGTGAAATTCTCGAGAATTTCACGAATGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002660.2-2062s21c1
Sequence:GTACCGGTGAGTTTGAGATGCGACTTTCCTCGAGGAAAGTCGCATCTCAAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002660
VALIDATED
PLCG1 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, gamma 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002660.2-4402s1c1
Sequence:CCGGCCAGGGAAACAAAGTTTACATCTCGAGATGTAAACTTTGTTTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002660.2-1619s1c1
Sequence:CCGGCCTGTGAACCACGAATGGTATCTCGAGATACCATTCGTGGTTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002660.2-3562s1c1
Sequence:CCGGCCAGATCAGTAACCCTGAATTCTCGAGAATTCAGGGTTACTGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002660.2-335s1c1
Sequence:CCGGGCCATTGACATTCGTGAAATTCTCGAGAATTTCACGAATGTCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002660.2-427s1c1
Sequence:CCGGCCAGTCACATTGCTTTGTCATCTCGAGATGACAAAGCAATGTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002660.2-3735s21c1
Sequence:GTACCGGTGCTGATCAAGATTGACATTTCTCGAGAAATGTCAATCTTGATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002660.2-3114s21c1
Sequence:GTACCGGAGAAGTTCCTTCAGTACAATCCTCGAGGATTGTACTGAAGGAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002660.2-4213s21c1
Sequence:CCGGCTGTACTGTGTTTCGCATTAACTCGAGTTAATGCGAAACACAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002660.2-1235s21c1
Sequence:CCGGCCGGATGGGATGCCAGTTATTCTCGAGAATAACTGGCATCCCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002660.2-618s21c1
Sequence:CCGGGGAATCGTGAGGATCGTATATCTCGAGATATACGATCCTCACGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002660.2-335s21c1
Sequence:CCGGGCCATTGACATTCGTGAAATTCTCGAGAATTTCACGAATGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002660.2-2062s21c1
Sequence:GTACCGGTGAGTTTGAGATGCGACTTTCCTCGAGGAAAGTCGCATCTCAAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021280
VALIDATED
PLCG1 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, gamma 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021280.2-3232s1c1
Sequence:CCGGGCCAGCTTGTAGCACTCAATTCTCGAGAATTGAGTGCTACAAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021280.2-434s1c1
Sequence:CCGGGCCAGATCAATCACACTGCTTCTCGAGAAGCAGTGTGATTGATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021280.2-2502s1c1
Sequence:CCGGCCAACTTTCAAGTGTGCAGTACTCGAGTACTGCACACTTGAAAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021280.2-1632s1c1
Sequence:CCGGCCCGTGAATCATGAGTGGTATCTCGAGATACCACTCATGATTCACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021280.3-3575s21c1
Sequence:CCGGCCAGATCAGTAACCCAGAGTTCTCGAGAACTCTGGGTTACTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021280.3-4105s21c1
Sequence:CCGGTTTGGAGGACAAAGTCATTACCTCGAGGTAATGACTTTGTCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-434s21c1
Sequence:CCGGGCCAGATCAATCACACTGCTTCTCGAGAAGCAGTGTGATTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021280.3-3232s21c1
Sequence:CCGGGCCAGCTTGTAGCACTCAATTCTCGAGAATTGAGTGCTACAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-2502s21c1
Sequence:CCGGCCAACTTTCAAGTGTGCAGTACTCGAGTACTGCACACTTGAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021280.3-4059s21c1
Sequence:CCGGGAAGATGCTGGCCTCTATGATCTCGAGATCATAGAGGCCAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-3184s21c1
Sequence:CCGGGGCTAGACTCCTCCAATTATGCTCGAGCATAATTGGAGGAGTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-632s21c1
Sequence:CCGGTAACCGAGAGGATCGTATATCCTCGAGGATATACGATCCTCTCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-347s21c1
Sequence:CCGGGTCCATTGATATCCGAGAAATCTCGAGATTTCTCGGATATCAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021280
VALIDATED
PLCG1 MISSION shRNA shRNA Plasmid DNA
phospholipase C, gamma 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021280.2-3232s1c1
Sequence:CCGGGCCAGCTTGTAGCACTCAATTCTCGAGAATTGAGTGCTACAAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021280.2-434s1c1
Sequence:CCGGGCCAGATCAATCACACTGCTTCTCGAGAAGCAGTGTGATTGATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021280.2-2502s1c1
Sequence:CCGGCCAACTTTCAAGTGTGCAGTACTCGAGTACTGCACACTTGAAAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021280.2-1632s1c1
Sequence:CCGGCCCGTGAATCATGAGTGGTATCTCGAGATACCACTCATGATTCACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021280.3-3575s21c1
Sequence:CCGGCCAGATCAGTAACCCAGAGTTCTCGAGAACTCTGGGTTACTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021280.3-4105s21c1
Sequence:CCGGTTTGGAGGACAAAGTCATTACCTCGAGGTAATGACTTTGTCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-434s21c1
Sequence:CCGGGCCAGATCAATCACACTGCTTCTCGAGAAGCAGTGTGATTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021280.3-3232s21c1
Sequence:CCGGGCCAGCTTGTAGCACTCAATTCTCGAGAATTGAGTGCTACAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-2502s21c1
Sequence:CCGGCCAACTTTCAAGTGTGCAGTACTCGAGTACTGCACACTTGAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021280.3-4059s21c1
Sequence:CCGGGAAGATGCTGGCCTCTATGATCTCGAGATCATAGAGGCCAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-3184s21c1
Sequence:CCGGGGCTAGACTCCTCCAATTATGCTCGAGCATAATTGGAGGAGTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-632s21c1
Sequence:CCGGTAACCGAGAGGATCGTATATCCTCGAGGATATACGATCCTCTCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-347s21c1
Sequence:CCGGGTCCATTGATATCCGAGAAATCTCGAGATTTCTCGGATATCAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021280
VALIDATED
PLCG1 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, gamma 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021280.2-3232s1c1
Sequence:CCGGGCCAGCTTGTAGCACTCAATTCTCGAGAATTGAGTGCTACAAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021280.2-434s1c1
Sequence:CCGGGCCAGATCAATCACACTGCTTCTCGAGAAGCAGTGTGATTGATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021280.2-2502s1c1
Sequence:CCGGCCAACTTTCAAGTGTGCAGTACTCGAGTACTGCACACTTGAAAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021280.2-1632s1c1
Sequence:CCGGCCCGTGAATCATGAGTGGTATCTCGAGATACCACTCATGATTCACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021280.3-3575s21c1
Sequence:CCGGCCAGATCAGTAACCCAGAGTTCTCGAGAACTCTGGGTTACTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021280.3-4105s21c1
Sequence:CCGGTTTGGAGGACAAAGTCATTACCTCGAGGTAATGACTTTGTCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-434s21c1
Sequence:CCGGGCCAGATCAATCACACTGCTTCTCGAGAAGCAGTGTGATTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021280.3-3232s21c1
Sequence:CCGGGCCAGCTTGTAGCACTCAATTCTCGAGAATTGAGTGCTACAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-2502s21c1
Sequence:CCGGCCAACTTTCAAGTGTGCAGTACTCGAGTACTGCACACTTGAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021280.3-4059s21c1
Sequence:CCGGGAAGATGCTGGCCTCTATGATCTCGAGATCATAGAGGCCAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-3184s21c1
Sequence:CCGGGGCTAGACTCCTCCAATTATGCTCGAGCATAATTGGAGGAGTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-632s21c1
Sequence:CCGGTAACCGAGAGGATCGTATATCCTCGAGGATATACGATCCTCTCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021280.3-347s21c1
Sequence:CCGGGTCCATTGATATCCGAGAAATCTCGAGATTTCTCGGATATCAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks