EMAIL THIS PAGE TO A FRIEND

PLCZ1

phospholipase C, zeta 1

Synonyms: NYD-SP27 PLC-zeta-1 PLCzeta
UniProtKB ID: Q86YW0, Q08AQ7, Q96J70
Gene ID:
Human(89869) Summary: The protein encoded by this gene is a member of the phosphoinositide-specific phospholipase C family. Members in this family, classified into six isotypes that are tissue- and organ-specific, hydrolyze phosphatidylinositol 4,5-bisphosphate just before the phosphate group to yield diacylglycerol and inositol 1,4,5-trisphosphate. This protein localizes to the acrosome in spermatozoa and elicits Ca(2+) oscillations and egg activation during fertilization that leads to early embryonic development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(114875) phospholipase C, zeta 1
Rat(497197) phospholipase C, zeta 1
cow(497026) phospholipase C, zeta 1
sheep(101122850) phospholipase C, zeta 1
domestic guinea pig(100716367) phospholipase C, zeta 1
naked mole-rat(101709944) phospholipase C, zeta 1
chicken(418182) phospholipase C, zeta 1
dog(486657) phospholipase C, zeta 1
domestic cat(101085554) phospholipase C, zeta 1
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033123 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072431 MISSION® esiRNA esiRNA human PLCZ1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033123 Rosetta Predictions human pricing
NM_001012234 Rosetta Predictions rat pricing
NM_054066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109462 predicted 355
2 SASI_Hs01_00109463 predicted 562
3 SASI_Hs01_00109464 predicted 700
4 SASI_Hs01_00109466 predicted 609
5 SASI_Hs02_00360851 predicted 466
6 SASI_Hs01_00109468 predicted 1467
7 SASI_Hs01_00109469 predicted 1098
8 SASI_Hs01_00109470 predicted 1006
9 SASI_Hs02_00360852 predicted 659
10 SASI_Hs02_00360853 predicted 1539
11 SASI_Hs01_00109465 predicted 294
12 SASI_Hs01_00109467 predicted 458
13 SASI_Hs01_00109471 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098718 predicted 697
2 SASI_Rn01_00098719 predicted 204
3 SASI_Rn01_00098720 predicted 493
4 SASI_Rn01_00098721 predicted 1145
5 SASI_Rn01_00098722 predicted 209
6 SASI_Rn02_00200497 predicted 439
7 SASI_Rn01_00098723 predicted 362
8 SASI_Rn01_00098724 predicted 479
9 SASI_Rn01_00098725 predicted 1186
10 SASI_Rn01_00098726 predicted 461
11 SASI_Rn01_00098727 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083795 predicted 936
2 SASI_Mm01_00083796 predicted 1903
3 SASI_Mm01_00083797 predicted 1012
4 SASI_Mm02_00337993 predicted 1042
5 SASI_Mm01_00083798 predicted 1292
6 SASI_Mm01_00083800 predicted 907
7 SASI_Mm01_00083801 predicted 1493
8 SASI_Mm01_00083802 predicted 668
9 SASI_Mm02_00337994 predicted 1371
10 SASI_Mm01_00083803 predicted 1783
11 SASI_Mm01_00083799 predicted 867
12 SASI_Mm01_00083804 predicted 1878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054066
PLCZ1 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, zeta 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054066.4-1402s21c1
Sequence:CCGGAGAGTCTATCAGCAATTTAATCTCGAGATTAAATTGCTGATAGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054066.4-604s21c1
Sequence:CCGGATTGAAGGTTTCGCAAGATACCTCGAGGTATCTTGCGAAACCTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054066.4-394s21c1
Sequence:CCGGAGAGCCATTTACCGGTGTATTCTCGAGAATACACCGGTAAATGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054066.4-1380s21c1
Sequence:CCGGGTTCCGAAACTTCCAATATTCCTCGAGGAATATTGGAAGTTTCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-680s1c1
Sequence:CCGGCCAAGATATGAATCATCCATTCTCGAGAATGGATGATTCATATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-2028s1c1
Sequence:CCGGCCAGTTCTTTGCATGAACAAACTCGAGTTTGTTCATGCAAAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-1348s1c1
Sequence:CCGGCCTTATCTGATCTTGTCATTTCTCGAGAAATGACAAGATCAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-909s1c1
Sequence:CCGGGCAATAAACAAGTATGCCTTTCTCGAGAAAGGCATACTTGTTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-1284s1c1
Sequence:CCGGCCCTCGACATTGAGTGGAATACTCGAGTATTCCACTCAATGTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054066
PLCZ1 MISSION shRNA shRNA Plasmid DNA
phospholipase C, zeta 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054066.4-1402s21c1
Sequence:CCGGAGAGTCTATCAGCAATTTAATCTCGAGATTAAATTGCTGATAGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054066.4-604s21c1
Sequence:CCGGATTGAAGGTTTCGCAAGATACCTCGAGGTATCTTGCGAAACCTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054066.4-394s21c1
Sequence:CCGGAGAGCCATTTACCGGTGTATTCTCGAGAATACACCGGTAAATGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054066.4-1380s21c1
Sequence:CCGGGTTCCGAAACTTCCAATATTCCTCGAGGAATATTGGAAGTTTCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-680s1c1
Sequence:CCGGCCAAGATATGAATCATCCATTCTCGAGAATGGATGATTCATATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-2028s1c1
Sequence:CCGGCCAGTTCTTTGCATGAACAAACTCGAGTTTGTTCATGCAAAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-1348s1c1
Sequence:CCGGCCTTATCTGATCTTGTCATTTCTCGAGAAATGACAAGATCAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-909s1c1
Sequence:CCGGGCAATAAACAAGTATGCCTTTCTCGAGAAAGGCATACTTGTTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-1284s1c1
Sequence:CCGGCCCTCGACATTGAGTGGAATACTCGAGTATTCCACTCAATGTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054066
PLCZ1 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, zeta 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054066.4-1402s21c1
Sequence:CCGGAGAGTCTATCAGCAATTTAATCTCGAGATTAAATTGCTGATAGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054066.4-604s21c1
Sequence:CCGGATTGAAGGTTTCGCAAGATACCTCGAGGTATCTTGCGAAACCTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054066.4-394s21c1
Sequence:CCGGAGAGCCATTTACCGGTGTATTCTCGAGAATACACCGGTAAATGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054066.4-1380s21c1
Sequence:CCGGGTTCCGAAACTTCCAATATTCCTCGAGGAATATTGGAAGTTTCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-680s1c1
Sequence:CCGGCCAAGATATGAATCATCCATTCTCGAGAATGGATGATTCATATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-2028s1c1
Sequence:CCGGCCAGTTCTTTGCATGAACAAACTCGAGTTTGTTCATGCAAAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-1348s1c1
Sequence:CCGGCCTTATCTGATCTTGTCATTTCTCGAGAAATGACAAGATCAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-909s1c1
Sequence:CCGGGCAATAAACAAGTATGCCTTTCTCGAGAAAGGCATACTTGTTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054066.2-1284s1c1
Sequence:CCGGCCCTCGACATTGAGTGGAATACTCGAGTATTCCACTCAATGTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033123
PLCZ1 MISSION shRNA Bacterial Glycerol Stock
phospholipase C, zeta 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033123.2-1600s21c1
Sequence:CCGGACTTTAACCCAAGTAACATAACTCGAGTTATGTTACTTGGGTTAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033123.2-656s21c1
Sequence:CCGGAGATATGACTCATCCATTAAACTCGAGTTTAATGGATGAGTCATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033123.2-285s21c1
Sequence:CCGGGATATTCGGTGCAGTTATATTCTCGAGAATATAACTGCACCGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-1980s1c1
Sequence:CCGGCCTGCTTCACTGTTTGTTTATCTCGAGATAAACAAACAGTGAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-1864s1c1
Sequence:CCGGGTCAAGGTTTAATAGCAGGAACTCGAGTTCCTGCTATTAAACCTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-1672s1c1
Sequence:CCGGTGCCTCTTACTCATTCATCATCTCGAGATGATGAATGAGTAAGAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-358s1c1
Sequence:CCGGCCATAGAAGAATTTAGAGCAACTCGAGTTGCTCTAAATTCTTCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-612s1c1
Sequence:CCGGCGTGAATGTCTACTGTTTAAACTCGAGTTTAAACAGTAGACATTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033123
PLCZ1 MISSION shRNA shRNA Plasmid DNA
phospholipase C, zeta 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033123.2-1600s21c1
Sequence:CCGGACTTTAACCCAAGTAACATAACTCGAGTTATGTTACTTGGGTTAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033123.2-656s21c1
Sequence:CCGGAGATATGACTCATCCATTAAACTCGAGTTTAATGGATGAGTCATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033123.2-285s21c1
Sequence:CCGGGATATTCGGTGCAGTTATATTCTCGAGAATATAACTGCACCGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-1980s1c1
Sequence:CCGGCCTGCTTCACTGTTTGTTTATCTCGAGATAAACAAACAGTGAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-1864s1c1
Sequence:CCGGGTCAAGGTTTAATAGCAGGAACTCGAGTTCCTGCTATTAAACCTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-1672s1c1
Sequence:CCGGTGCCTCTTACTCATTCATCATCTCGAGATGATGAATGAGTAAGAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-358s1c1
Sequence:CCGGCCATAGAAGAATTTAGAGCAACTCGAGTTGCTCTAAATTCTTCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-612s1c1
Sequence:CCGGCGTGAATGTCTACTGTTTAAACTCGAGTTTAAACAGTAGACATTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033123
PLCZ1 MISSION shRNA Lentiviral Transduction Particles
phospholipase C, zeta 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033123.2-1600s21c1
Sequence:CCGGACTTTAACCCAAGTAACATAACTCGAGTTATGTTACTTGGGTTAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033123.2-656s21c1
Sequence:CCGGAGATATGACTCATCCATTAAACTCGAGTTTAATGGATGAGTCATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033123.2-285s21c1
Sequence:CCGGGATATTCGGTGCAGTTATATTCTCGAGAATATAACTGCACCGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-1980s1c1
Sequence:CCGGCCTGCTTCACTGTTTGTTTATCTCGAGATAAACAAACAGTGAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-1864s1c1
Sequence:CCGGGTCAAGGTTTAATAGCAGGAACTCGAGTTCCTGCTATTAAACCTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-1672s1c1
Sequence:CCGGTGCCTCTTACTCATTCATCATCTCGAGATGATGAATGAGTAAGAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-358s1c1
Sequence:CCGGCCATAGAAGAATTTAGAGCAACTCGAGTTGCTCTAAATTCTTCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033123.x-612s1c1
Sequence:CCGGCGTGAATGTCTACTGTTTAAACTCGAGTTTAAACAGTAGACATTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks