EMAIL THIS PAGE TO A FRIEND

PLD5

phospholipase D family, member 5

Synonyms: PLDC
UniProtKB ID: Q8N7P1, A1KXV0, B7Z324, Q494U9, Q8NB22
Gene ID:
Mouse(319455) phospholipase D family, member 5
Rat(289270) phospholipase D family, member 5
naked mole-rat(101704829) phospholipase D family, member 5
domestic guinea pig(100724036) phospholipase D family, member 5
cow(617120) phospholipase D family, member 5
sheep(101119741) phospholipase D family, member 5
chicken(421501) phospholipase D family, member 5
domestic cat(101094073) phospholipase D family, member 5
dog(490372) phospholipase D family, member 5
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
D1262 P1,P4-Di(adenosine-5′) tetraphosphate ammonium salt ≥95% (HPLC), powder human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D6908 DL-erythro-Dihydrosphingosine ≥99%, synthetic human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152666 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152666 Rosetta Predictions human pricing
XM_001058940 Rosetta Predictions rat pricing
XM_222934 Rosetta Predictions rat pricing
NM_176916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224686 predicted 1015
2 SASI_Hs01_00224687 predicted 1606
3 SASI_Hs01_00224688 predicted 1351
4 SASI_Hs01_00224689 predicted 1028
5 SASI_Hs01_00224690 predicted 1143
6 SASI_Hs01_00224691 predicted 675
7 SASI_Hs01_00224692 predicted 1826
8 SASI_Hs01_00224693 predicted 1353
9 SASI_Hs01_00224694 predicted 1523
10 SASI_Hs01_00224695 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291343 predicted 1004
2 SASI_Rn02_00291344 predicted 849
3 SASI_Rn02_00291345 predicted 574
4 SASI_Rn02_00291346 predicted 320
5 SASI_Rn02_00291347 predicted 777
6 SASI_Rn02_00291348 predicted 1445
7 SASI_Rn02_00291349 predicted 852
8 SASI_Rn02_00291350 predicted 1178
9 SASI_Rn02_00291351 predicted 707
10 SASI_Rn02_00291352 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380997 predicted 848
2 SASI_Rn02_00380998 predicted 318
3 SASI_Rn02_00380999 predicted 988
4 SASI_Rn02_00381000 predicted 261
5 SASI_Rn02_00381001 predicted 976
6 SASI_Rn02_00381002 predicted 926
7 SASI_Rn02_00381003 predicted 833
8 SASI_Rn02_00381004 predicted 893
9 SASI_Rn02_00381005 predicted 918
10 SASI_Rn02_00381006 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143122 predicted 1219
2 SASI_Mm01_00143123 predicted 2033
3 SASI_Mm01_00143124 predicted 1015
4 SASI_Mm01_00143125 predicted 1290
5 SASI_Mm01_00143126 predicted 558
6 SASI_Mm01_00143127 predicted 1662
7 SASI_Mm01_00143128 predicted 1501
8 SASI_Mm02_00346794 predicted 1009
9 SASI_Mm01_00143129 predicted 1148
10 SASI_Mm01_00143130 predicted 1919
11 SASI_Mm01_00143131 predicted 2068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152666
PLD5 MISSION shRNA Bacterial Glycerol Stock
phospholipase D family, member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-1574s1c1
Sequence:CCGGGAGCAGCTTATATTGGAAATTCTCGAGAATTTCCAATATAAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-1129s1c1
Sequence:CCGGCTTCAGTTGAATGAAACCAAACTCGAGTTTGGTTTCATTCAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-1007s1c1
Sequence:CCGGGCCTGGTCCTAGATTTACAAACTCGAGTTTGTAAATCTAGGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-846s1c1
Sequence:CCGGCGAGGTGACGTACATGAACATCTCGAGATGTTCATGTACGTCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-1358s1c1
Sequence:CCGGGCGTTAGAGTTCGACTCCTTTCTCGAGAAAGGAGTCGAACTCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152666.1-912s21c1
Sequence:CCGGGGACAAACAGCACGTGTATATCTCGAGATATACACGTGCTGTTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152666.1-1675s21c1
Sequence:CCGGAGCATCATTAAGCAACTTAAACTCGAGTTTAAGTTGCTTAATGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152666.1-796s21c1
Sequence:CCGGGATGTAACAGCTGATTCAAAGCTCGAGCTTTGAATCAGCTGTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152666.1-1528s21c1
Sequence:CCGGCACACCTTTCCTAGGTTAAATCTCGAGATTTAACCTAGGAAAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152666
PLD5 MISSION shRNA shRNA Plasmid DNA
phospholipase D family, member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-1574s1c1
Sequence:CCGGGAGCAGCTTATATTGGAAATTCTCGAGAATTTCCAATATAAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-1129s1c1
Sequence:CCGGCTTCAGTTGAATGAAACCAAACTCGAGTTTGGTTTCATTCAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-1007s1c1
Sequence:CCGGGCCTGGTCCTAGATTTACAAACTCGAGTTTGTAAATCTAGGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-846s1c1
Sequence:CCGGCGAGGTGACGTACATGAACATCTCGAGATGTTCATGTACGTCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-1358s1c1
Sequence:CCGGGCGTTAGAGTTCGACTCCTTTCTCGAGAAAGGAGTCGAACTCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152666.1-912s21c1
Sequence:CCGGGGACAAACAGCACGTGTATATCTCGAGATATACACGTGCTGTTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152666.1-1675s21c1
Sequence:CCGGAGCATCATTAAGCAACTTAAACTCGAGTTTAAGTTGCTTAATGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152666.1-796s21c1
Sequence:CCGGGATGTAACAGCTGATTCAAAGCTCGAGCTTTGAATCAGCTGTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152666.1-1528s21c1
Sequence:CCGGCACACCTTTCCTAGGTTAAATCTCGAGATTTAACCTAGGAAAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152666
PLD5 MISSION shRNA Lentiviral Transduction Particles
phospholipase D family, member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-1574s1c1
Sequence:CCGGGAGCAGCTTATATTGGAAATTCTCGAGAATTTCCAATATAAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-1129s1c1
Sequence:CCGGCTTCAGTTGAATGAAACCAAACTCGAGTTTGGTTTCATTCAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-1007s1c1
Sequence:CCGGGCCTGGTCCTAGATTTACAAACTCGAGTTTGTAAATCTAGGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-846s1c1
Sequence:CCGGCGAGGTGACGTACATGAACATCTCGAGATGTTCATGTACGTCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152666.1-1358s1c1
Sequence:CCGGGCGTTAGAGTTCGACTCCTTTCTCGAGAAAGGAGTCGAACTCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152666.1-912s21c1
Sequence:CCGGGGACAAACAGCACGTGTATATCTCGAGATATACACGTGCTGTTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152666.1-1675s21c1
Sequence:CCGGAGCATCATTAAGCAACTTAAACTCGAGTTTAAGTTGCTTAATGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152666.1-796s21c1
Sequence:CCGGGATGTAACAGCTGATTCAAAGCTCGAGCTTTGAATCAGCTGTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152666.1-1528s21c1
Sequence:CCGGCACACCTTTCCTAGGTTAAATCTCGAGATTTAACCTAGGAAAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176916
PLD5 MISSION shRNA Bacterial Glycerol Stock
phospholipase D family, member 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176916.2-358s1c1
Sequence:CCGGGTCGAATCGCTCTTGTGGAAACTCGAGTTTCCACAAGAGCGATTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176916.2-607s1c1
Sequence:CCGGCAGATTCAAAGGTGCTGAGGTCTCGAGACCTCAGCACCTTTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176916.2-2268s1c1
Sequence:CCGGCGAGTCCACAACTGAAGATTACTCGAGTAATCTTCAGTTGTGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176916.4-3396s21c1
Sequence:CCGGCTGTCATGGTAGGCGATATTTCTCGAGAAATATCGCCTACCATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176916.4-1779s21c1
Sequence:CCGGGGCAGCTTACATCGGAAATTTCTCGAGAAATTTCCGATGTAAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176916.4-1237s21c1
Sequence:CCGGTTCGCTTTATATAGCTCATTACTCGAGTAATGAGCTATATAAAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176916.4-1625s21c1
Sequence:CCGGTCTCGTCTCTTAAAGCTATTTCTCGAGAAATAGCTTTAAGAGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176916.4-1006s21c1
Sequence:CCGGACCGCAGATTCAAAGGTATTACTCGAGTAATACCTTTGAATCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176916
PLD5 MISSION shRNA shRNA Plasmid DNA
phospholipase D family, member 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176916.2-358s1c1
Sequence:CCGGGTCGAATCGCTCTTGTGGAAACTCGAGTTTCCACAAGAGCGATTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176916.2-607s1c1
Sequence:CCGGCAGATTCAAAGGTGCTGAGGTCTCGAGACCTCAGCACCTTTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176916.2-2268s1c1
Sequence:CCGGCGAGTCCACAACTGAAGATTACTCGAGTAATCTTCAGTTGTGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176916.4-3396s21c1
Sequence:CCGGCTGTCATGGTAGGCGATATTTCTCGAGAAATATCGCCTACCATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176916.4-1779s21c1
Sequence:CCGGGGCAGCTTACATCGGAAATTTCTCGAGAAATTTCCGATGTAAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176916.4-1237s21c1
Sequence:CCGGTTCGCTTTATATAGCTCATTACTCGAGTAATGAGCTATATAAAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176916.4-1625s21c1
Sequence:CCGGTCTCGTCTCTTAAAGCTATTTCTCGAGAAATAGCTTTAAGAGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176916.4-1006s21c1
Sequence:CCGGACCGCAGATTCAAAGGTATTACTCGAGTAATACCTTTGAATCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176916
PLD5 MISSION shRNA Lentiviral Transduction Particles
phospholipase D family, member 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176916.2-358s1c1
Sequence:CCGGGTCGAATCGCTCTTGTGGAAACTCGAGTTTCCACAAGAGCGATTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176916.2-607s1c1
Sequence:CCGGCAGATTCAAAGGTGCTGAGGTCTCGAGACCTCAGCACCTTTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176916.2-2268s1c1
Sequence:CCGGCGAGTCCACAACTGAAGATTACTCGAGTAATCTTCAGTTGTGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176916.4-3396s21c1
Sequence:CCGGCTGTCATGGTAGGCGATATTTCTCGAGAAATATCGCCTACCATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176916.4-1779s21c1
Sequence:CCGGGGCAGCTTACATCGGAAATTTCTCGAGAAATTTCCGATGTAAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176916.4-1237s21c1
Sequence:CCGGTTCGCTTTATATAGCTCATTACTCGAGTAATGAGCTATATAAAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176916.4-1625s21c1
Sequence:CCGGTCTCGTCTCTTAAAGCTATTTCTCGAGAAATAGCTTTAAGAGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176916.4-1006s21c1
Sequence:CCGGACCGCAGATTCAAAGGTATTACTCGAGTAATACCTTTGAATCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks