EMAIL THIS PAGE TO A FRIEND

PLEKHA4

pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4

Synonyms: PEPP1
UniProtKB ID: Q9H4M7, Q8N4M8, Q8N658
Gene ID:
Mouse(69217) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Rat(308584) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Horse(100054587) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
dog(484393) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
domestic cat(101084842) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
cow(510748) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
sheep(101102005) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
domestic guinea pig(100731639) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
naked mole-rat(101717286) pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020904 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133051 MISSION® esiRNA esiRNA human PLEKHA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020904 Rosetta Predictions human pricing
NM_199101 Rosetta Predictions rat pricing
NM_148927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152533 predicted 895
2 SASI_Hs01_00152535 predicted 828
3 SASI_Hs02_00354240 predicted 631
4 SASI_Hs01_00152537 predicted 2531
5 SASI_Hs01_00152539 predicted 742
6 SASI_Hs02_00354241 predicted 1583
7 SASI_Hs01_00152540 predicted 650
8 SASI_Hs01_00152541 predicted 2558
9 SASI_Hs01_00152542 predicted 2552
10 SASI_Hs02_00354242 predicted 2601
11 SASI_Hs01_00152534 predicted 874
12 SASI_Hs01_00152536 predicted 1591
13 SASI_Hs01_00152538 predicted 2466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038101 predicted 2429
2 SASI_Rn01_00038102 predicted 617
3 SASI_Rn02_00270120 predicted 2177
4 SASI_Rn01_00038103 predicted 2467
5 SASI_Rn01_00038104 predicted 1358
6 SASI_Rn01_00038105 predicted 1337
7 SASI_Rn01_00038106 predicted 1328
8 SASI_Rn01_00038107 predicted 651
9 SASI_Rn01_00038108 predicted 2173
10 SASI_Rn01_00038109 predicted 442
11 SASI_Rn01_00038100 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342727 predicted 366
2 SASI_Mm02_00342728 predicted 2029
3 SASI_Mm02_00342729 predicted 1215
4 SASI_Mm02_00342730 predicted 2032
5 SASI_Mm02_00342731 predicted 689
6 SASI_Mm02_00342732 predicted 497
7 SASI_Mm02_00342733 predicted 369
8 SASI_Mm02_00342734 predicted 1190
9 SASI_Mm02_00342735 predicted 922
10 SASI_Mm02_00342736 predicted 1312
11 SASI_Mm01_00109740 predicted 1690
12 SASI_Mm01_00109741 predicted 676
13 SASI_Mm01_00109742 predicted 1174
14 SASI_Mm01_00109743 predicted 1650
15 SASI_Mm01_00109744 predicted 707
16 SASI_Mm01_00109745 predicted 472
17 SASI_Mm01_00109746 predicted 417
18 SASI_Mm01_00109747 predicted 432
19 SASI_Mm01_00109748 predicted 504
20 SASI_Mm01_00109749 predicted 1838
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148927
PLEKHA4 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148927.1-1653s1c1
Sequence:CCGGACCCTGGAATGGAACTTAAATCTCGAGATTTAAGTTCCATTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148927.1-884s1c1
Sequence:CCGGGCATACTCCTTTGAGTCGCATCTCGAGATGCGACTCAAAGGAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148927.1-1692s1c1
Sequence:CCGGGTACCCTTATCTGCGGAGATACTCGAGTATCTCCGCAGATAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148927.1-421s1c1
Sequence:CCGGCCATTGCCTCTTCTACTATAACTCGAGTTATAGTAGAAGAGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148927.1-2457s1c1
Sequence:CCGGCCATCTTTATACTGAGCCCTACTCGAGTAGGGCTCAGTATAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148927
PLEKHA4 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148927.1-1653s1c1
Sequence:CCGGACCCTGGAATGGAACTTAAATCTCGAGATTTAAGTTCCATTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148927.1-884s1c1
Sequence:CCGGGCATACTCCTTTGAGTCGCATCTCGAGATGCGACTCAAAGGAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148927.1-1692s1c1
Sequence:CCGGGTACCCTTATCTGCGGAGATACTCGAGTATCTCCGCAGATAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148927.1-421s1c1
Sequence:CCGGCCATTGCCTCTTCTACTATAACTCGAGTTATAGTAGAAGAGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148927.1-2457s1c1
Sequence:CCGGCCATCTTTATACTGAGCCCTACTCGAGTAGGGCTCAGTATAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148927
PLEKHA4 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148927.1-1653s1c1
Sequence:CCGGACCCTGGAATGGAACTTAAATCTCGAGATTTAAGTTCCATTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148927.1-884s1c1
Sequence:CCGGGCATACTCCTTTGAGTCGCATCTCGAGATGCGACTCAAAGGAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148927.1-1692s1c1
Sequence:CCGGGTACCCTTATCTGCGGAGATACTCGAGTATCTCCGCAGATAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148927.1-421s1c1
Sequence:CCGGCCATTGCCTCTTCTACTATAACTCGAGTTATAGTAGAAGAGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148927.1-2457s1c1
Sequence:CCGGCCATCTTTATACTGAGCCCTACTCGAGTAGGGCTCAGTATAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020904
VALIDATED
PLEKHA4 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020904.1-2589s1c1
Sequence:CCGGCAGAATGATGACAGGTGGAAACTCGAGTTTCCACCTGTCATCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020904.1-2591s1c1
Sequence:CCGGGAATGATGACAGGTGGAAATTCTCGAGAATTTCCACCTGTCATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020904.1-833s1c1
Sequence:CCGGGCTACAATATTAGACCAGATGCTCGAGCATCTGGTCTAATATTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020904.1-1693s1c1
Sequence:CCGGGAGGAGAAGGAGCAACTAGAACTCGAGTTCTAGTTGCTCCTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020904.1-1585s1c1
Sequence:CCGGCTGGAGTCAACTTTCCACCAACTCGAGTTGGTGGAAAGTTGACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020904.1-1590s1c1
Sequence:CCGGGTCAACTTTCCACCAAAGCTTCTCGAGAAGCTTTGGTGGAAAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020904.1-1600s1c1
Sequence:CCGGCACCAAAGCTTGGAGACAGATCTCGAGATCTGTCTCCAAGCTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020904.2-1364s21c1
Sequence:CCGGCCCGTTGAGTCGCATTGATGTCTCGAGACATCAATGCGACTCAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020904.2-2342s21c1
Sequence:CCGGGATGCGCAGAAACCAGGAATGCTCGAGCATTCCTGGTTTCTGCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020904.2-2861s21c1
Sequence:CCGGGCGAGTCACTCTGCTACAATCCTCGAGGATTGTAGCAGAGTGACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020904
VALIDATED
PLEKHA4 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020904.1-2589s1c1
Sequence:CCGGCAGAATGATGACAGGTGGAAACTCGAGTTTCCACCTGTCATCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020904.1-2591s1c1
Sequence:CCGGGAATGATGACAGGTGGAAATTCTCGAGAATTTCCACCTGTCATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020904.1-833s1c1
Sequence:CCGGGCTACAATATTAGACCAGATGCTCGAGCATCTGGTCTAATATTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020904.1-1693s1c1
Sequence:CCGGGAGGAGAAGGAGCAACTAGAACTCGAGTTCTAGTTGCTCCTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020904.1-1585s1c1
Sequence:CCGGCTGGAGTCAACTTTCCACCAACTCGAGTTGGTGGAAAGTTGACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020904.1-1590s1c1
Sequence:CCGGGTCAACTTTCCACCAAAGCTTCTCGAGAAGCTTTGGTGGAAAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020904.1-1600s1c1
Sequence:CCGGCACCAAAGCTTGGAGACAGATCTCGAGATCTGTCTCCAAGCTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020904.2-1364s21c1
Sequence:CCGGCCCGTTGAGTCGCATTGATGTCTCGAGACATCAATGCGACTCAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020904.2-2342s21c1
Sequence:CCGGGATGCGCAGAAACCAGGAATGCTCGAGCATTCCTGGTTTCTGCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020904.2-2861s21c1
Sequence:CCGGGCGAGTCACTCTGCTACAATCCTCGAGGATTGTAGCAGAGTGACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020904
VALIDATED
PLEKHA4 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020904.1-2589s1c1
Sequence:CCGGCAGAATGATGACAGGTGGAAACTCGAGTTTCCACCTGTCATCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020904.1-2591s1c1
Sequence:CCGGGAATGATGACAGGTGGAAATTCTCGAGAATTTCCACCTGTCATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020904.1-833s1c1
Sequence:CCGGGCTACAATATTAGACCAGATGCTCGAGCATCTGGTCTAATATTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020904.1-1693s1c1
Sequence:CCGGGAGGAGAAGGAGCAACTAGAACTCGAGTTCTAGTTGCTCCTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020904.1-1585s1c1
Sequence:CCGGCTGGAGTCAACTTTCCACCAACTCGAGTTGGTGGAAAGTTGACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020904.1-1590s1c1
Sequence:CCGGGTCAACTTTCCACCAAAGCTTCTCGAGAAGCTTTGGTGGAAAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020904.1-1600s1c1
Sequence:CCGGCACCAAAGCTTGGAGACAGATCTCGAGATCTGTCTCCAAGCTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020904.2-1364s21c1
Sequence:CCGGCCCGTTGAGTCGCATTGATGTCTCGAGACATCAATGCGACTCAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020904.2-2342s21c1
Sequence:CCGGGATGCGCAGAAACCAGGAATGCTCGAGCATTCCTGGTTTCTGCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020904.2-2861s21c1
Sequence:CCGGGCGAGTCACTCTGCTACAATCCTCGAGGATTGTAGCAGAGTGACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks