EMAIL THIS PAGE TO A FRIEND

PLEKHA5

pleckstrin homology domain containing, family A member 5

Synonyms: PEPP-2 PEPP2
Gene ID:
Mouse(109135) pleckstrin homology domain containing, family A member 5
Rat(246237) pleckstrin homology domain containing, family A member 5
naked mole-rat(101707691) pleckstrin homology domain containing, family A member 5
Domestic Rabbit(100357579) pleckstrin homology domain containing, family A member 5
domestic guinea pig(100716917) pleckstrin homology domain containing, family A member 5
cow(532887) pleckstrin homology domain containing, family A member 5
sheep(101121844) pleckstrin homology domain containing, family A member 5
Zebrafish(567300) pleckstrin homology domain containing, family A member 5
Horse(100067899) pleckstrin homology domain containing, family A member 5
domestic cat(101085810) pleckstrin homology domain containing, family A member 5
dog(477679) pleckstrin homology domain containing, family A member 5
chicken(418183) pleckstrin homology domain containing, family A member 5
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019012 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019012 Rosetta Predictions human pricing
XM_001073627 Rosetta Predictions rat pricing
XM_342781 Rosetta Predictions rat pricing
NM_144920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064461 predicted 342
2 SASI_Hs01_00064462 predicted 1498
3 SASI_Hs02_00352539 predicted 2671
4 SASI_Hs01_00064463 predicted 374
5 SASI_Hs01_00064464 predicted 2584
6 SASI_Hs01_00064465 predicted 2617
7 SASI_Hs01_00064467 predicted 3214
8 SASI_Hs01_00064468 predicted 412
9 SASI_Hs01_00064469 predicted 1861
10 SASI_Hs02_00352540 predicted 2100
11 SASI_Hs01_00064460 predicted 1418
12 SASI_Hs01_00064466 predicted 2069
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343356 predicted 730
2 SASI_Rn02_00343357 predicted 1875
3 SASI_Rn02_00343358 predicted 2982
4 SASI_Rn02_00343359 predicted 1819
5 SASI_Rn02_00343360 predicted 1701
6 SASI_Rn02_00343361 predicted 914
7 SASI_Rn02_00343362 predicted 1863
8 SASI_Rn02_00343363 predicted 1937
9 SASI_Rn02_00343364 predicted 771
10 SASI_Rn02_00343365 predicted 1914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394781 predicted 1250
2 SASI_Rn02_00394782 predicted 1222
3 SASI_Rn02_00394783 predicted 1221
4 SASI_Rn02_00394784 predicted 1212
5 SASI_Rn02_00394785 predicted 1260
6 SASI_Rn02_00394786 predicted 1250
7 SASI_Rn02_00394787 predicted 1226
8 SASI_Rn02_00394788 predicted 1259
9 SASI_Rn02_00394789 predicted 1252
10 SASI_Rn02_00394790 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192538 predicted 3556
2 SASI_Mm02_00340409 predicted 803
3 SASI_Mm02_00340410 predicted 2081
4 SASI_Mm02_00340411 predicted 3904
5 SASI_Mm01_00192543 predicted 3383
6 SASI_Mm02_00340412 predicted 2914
7 SASI_Mm01_00192545 predicted 2230
8 SASI_Mm02_00340413 predicted 2124
9 SASI_Mm02_00340414 predicted 3916
10 SASI_Mm02_00340415 predicted 704
11 SASI_Mm01_00192539 predicted 677
12 SASI_Mm01_00192540 predicted 2863
13 SASI_Mm01_00192541 predicted 438
14 SASI_Mm01_00192542 predicted 1936
15 SASI_Mm01_00192544 predicted 305
16 SASI_Mm01_00192546 predicted 2393
17 SASI_Mm01_00192547 predicted 1228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144920
VALIDATED
PLEKHA5 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A member 5
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144920.3-2800s21c1
Sequence:CCGGCCTCCACTTCCTCGGTCTTATCTCGAGATAAGACCGAGGAAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144920.3-4219s21c1
Sequence:CCGGTTTGGACAAAGCCATGATTATCTCGAGATAATCATGGCTTTGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144920.3-4027s1c1
Sequence:CCGGGTAGTTCAGGTTTCTCATATTCTCGAGAATATGAGAAACCTGAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144920.3-2745s21c1
Sequence:CCGGGCCTTTCTCATCAGTTAAGTACTCGAGTACTTAACTGATGAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144920.3-1332s21c1
Sequence:CCGGGCAGTGGATTAAAGTCCAGAACTCGAGTTCTGGACTTTAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144920.3-1082s21c1
Sequence:CCGGACGGGCAAGATAGACCATTAACTCGAGTTAATGGTCTATCTTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144920.2-1368s1c1
Sequence:CCGGGCAGGTATTGATGCCAAATTACTCGAGTAATTTGGCATCAATACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144920.2-1390s1c1
Sequence:CCGGGCAGATTGTGTGAACAGGATACTCGAGTATCCTGTTCACACAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144920.2-719s1c1
Sequence:CCGGGCAGTGGATTAAAGTCCAGAACTCGAGTTCTGGACTTTAATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144920.2-3395s1c1
Sequence:CCGGCCACACAAATGCTGTTGCTTACTCGAGTAAGCAACAGCATTTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144920.2-3405s1c1
Sequence:CCGGGCTGTTGCTTAGCTTTCCTTTCTCGAGAAAGGAAAGCTAAGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144920.2-1844s1c1
Sequence:CCGGGCCTTTCTCATCAGTTAAGTACTCGAGTACTTAACTGATGAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144920
VALIDATED
PLEKHA5 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A member 5
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144920.3-2800s21c1
Sequence:CCGGCCTCCACTTCCTCGGTCTTATCTCGAGATAAGACCGAGGAAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144920.3-4219s21c1
Sequence:CCGGTTTGGACAAAGCCATGATTATCTCGAGATAATCATGGCTTTGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144920.3-4027s1c1
Sequence:CCGGGTAGTTCAGGTTTCTCATATTCTCGAGAATATGAGAAACCTGAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144920.3-2745s21c1
Sequence:CCGGGCCTTTCTCATCAGTTAAGTACTCGAGTACTTAACTGATGAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144920.3-1332s21c1
Sequence:CCGGGCAGTGGATTAAAGTCCAGAACTCGAGTTCTGGACTTTAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144920.3-1082s21c1
Sequence:CCGGACGGGCAAGATAGACCATTAACTCGAGTTAATGGTCTATCTTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144920.2-1368s1c1
Sequence:CCGGGCAGGTATTGATGCCAAATTACTCGAGTAATTTGGCATCAATACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144920.2-1390s1c1
Sequence:CCGGGCAGATTGTGTGAACAGGATACTCGAGTATCCTGTTCACACAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144920.2-719s1c1
Sequence:CCGGGCAGTGGATTAAAGTCCAGAACTCGAGTTCTGGACTTTAATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144920.2-3395s1c1
Sequence:CCGGCCACACAAATGCTGTTGCTTACTCGAGTAAGCAACAGCATTTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144920.2-3405s1c1
Sequence:CCGGGCTGTTGCTTAGCTTTCCTTTCTCGAGAAAGGAAAGCTAAGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144920.2-1844s1c1
Sequence:CCGGGCCTTTCTCATCAGTTAAGTACTCGAGTACTTAACTGATGAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144920
VALIDATED
PLEKHA5 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A member 5
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144920.3-2800s21c1
Sequence:CCGGCCTCCACTTCCTCGGTCTTATCTCGAGATAAGACCGAGGAAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144920.3-4219s21c1
Sequence:CCGGTTTGGACAAAGCCATGATTATCTCGAGATAATCATGGCTTTGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144920.3-4027s1c1
Sequence:CCGGGTAGTTCAGGTTTCTCATATTCTCGAGAATATGAGAAACCTGAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144920.3-2745s21c1
Sequence:CCGGGCCTTTCTCATCAGTTAAGTACTCGAGTACTTAACTGATGAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144920.3-1332s21c1
Sequence:CCGGGCAGTGGATTAAAGTCCAGAACTCGAGTTCTGGACTTTAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144920.3-1082s21c1
Sequence:CCGGACGGGCAAGATAGACCATTAACTCGAGTTAATGGTCTATCTTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144920.2-1368s1c1
Sequence:CCGGGCAGGTATTGATGCCAAATTACTCGAGTAATTTGGCATCAATACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144920.2-1390s1c1
Sequence:CCGGGCAGATTGTGTGAACAGGATACTCGAGTATCCTGTTCACACAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144920.2-719s1c1
Sequence:CCGGGCAGTGGATTAAAGTCCAGAACTCGAGTTCTGGACTTTAATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144920.2-3395s1c1
Sequence:CCGGCCACACAAATGCTGTTGCTTACTCGAGTAAGCAACAGCATTTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144920.2-3405s1c1
Sequence:CCGGGCTGTTGCTTAGCTTTCCTTTCTCGAGAAAGGAAAGCTAAGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144920.2-1844s1c1
Sequence:CCGGGCCTTTCTCATCAGTTAAGTACTCGAGTACTTAACTGATGAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019012
VALIDATED
PLEKHA5 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A member 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019012.3-2655s21c1
Sequence:CCGGACACCCGAATCTTCGACAATACTCGAGTATTGTCGAAGATTCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_019012.3-3636s21c1
Sequence:CCGGTTCGTAATCTCAAGGTTATTACTCGAGTAATAACCTTGAGATTACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_019012.3-1323s21c1
Sequence:CCGGCAGTTGGAACAGTGGATTAAACTCGAGTTTAATCCACTGTTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_019012.3-1441s21c1
Sequence:CCGGCCCGCTACCCTGAAGGTTATACTCGAGTATAACCTTCAGGGTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_019012.3-968s21c1
Sequence:CCGGCAACCATAGAGTGCTAATTAACTCGAGTTAATTAGCACTCTATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019012.2-1925s1c1
Sequence:CCGGGCCGATTATGTGAACAAGATACTCGAGTATCTTGTTCACATAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019012.2-2932s1c1
Sequence:CCGGGCAACAGAAATTGTTCAACTACTCGAGTAGTTGAACAATTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_019012.2-1805s1c1
Sequence:CCGGGCCTGACTTTACAGTCTGTTACTCGAGTAACAGACTGTAAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019012.2-859s1c1
Sequence:CCGGGCACCAACTAAAGAAACCAATCTCGAGATTGGTTTCTTTAGTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019012.2-355s1c1
Sequence:CCGGCGGCCAATAAGTATGATAAATCTCGAGATTTATCATACTTATTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019012
VALIDATED
PLEKHA5 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A member 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019012.3-2655s21c1
Sequence:CCGGACACCCGAATCTTCGACAATACTCGAGTATTGTCGAAGATTCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_019012.3-3636s21c1
Sequence:CCGGTTCGTAATCTCAAGGTTATTACTCGAGTAATAACCTTGAGATTACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_019012.3-1323s21c1
Sequence:CCGGCAGTTGGAACAGTGGATTAAACTCGAGTTTAATCCACTGTTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_019012.3-1441s21c1
Sequence:CCGGCCCGCTACCCTGAAGGTTATACTCGAGTATAACCTTCAGGGTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_019012.3-968s21c1
Sequence:CCGGCAACCATAGAGTGCTAATTAACTCGAGTTAATTAGCACTCTATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019012.2-1925s1c1
Sequence:CCGGGCCGATTATGTGAACAAGATACTCGAGTATCTTGTTCACATAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019012.2-2932s1c1
Sequence:CCGGGCAACAGAAATTGTTCAACTACTCGAGTAGTTGAACAATTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_019012.2-1805s1c1
Sequence:CCGGGCCTGACTTTACAGTCTGTTACTCGAGTAACAGACTGTAAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019012.2-859s1c1
Sequence:CCGGGCACCAACTAAAGAAACCAATCTCGAGATTGGTTTCTTTAGTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019012.2-355s1c1
Sequence:CCGGCGGCCAATAAGTATGATAAATCTCGAGATTTATCATACTTATTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019012
VALIDATED
PLEKHA5 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A member 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019012.3-2655s21c1
Sequence:CCGGACACCCGAATCTTCGACAATACTCGAGTATTGTCGAAGATTCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_019012.3-3636s21c1
Sequence:CCGGTTCGTAATCTCAAGGTTATTACTCGAGTAATAACCTTGAGATTACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_019012.3-1323s21c1
Sequence:CCGGCAGTTGGAACAGTGGATTAAACTCGAGTTTAATCCACTGTTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_019012.3-1441s21c1
Sequence:CCGGCCCGCTACCCTGAAGGTTATACTCGAGTATAACCTTCAGGGTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_019012.3-968s21c1
Sequence:CCGGCAACCATAGAGTGCTAATTAACTCGAGTTAATTAGCACTCTATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019012.2-1925s1c1
Sequence:CCGGGCCGATTATGTGAACAAGATACTCGAGTATCTTGTTCACATAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019012.2-2932s1c1
Sequence:CCGGGCAACAGAAATTGTTCAACTACTCGAGTAGTTGAACAATTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_019012.2-1805s1c1
Sequence:CCGGGCCTGACTTTACAGTCTGTTACTCGAGTAACAGACTGTAAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019012.2-859s1c1
Sequence:CCGGGCACCAACTAAAGAAACCAATCTCGAGATTGGTTTCTTTAGTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019012.2-355s1c1
Sequence:CCGGCGGCCAATAAGTATGATAAATCTCGAGATTTATCATACTTATTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks