EMAIL THIS PAGE TO A FRIEND

PLEKHB2

pleckstrin homology domain containing, family B (evectins) member 2

Synonyms: EVT2
Gene ID:
Mouse(226971) pleckstrin homology domain containing, family B (evectins) member 2
Rat(301337) pleckstrin homology domain containing, family B (evectins) member 2
cow(783000) pleckstrin homology domain containing, family B (evectins) member 2
sheep(101105216) pleckstrin homology domain containing, family B (evectins) member 2
domestic guinea pig(100721291) pleckstrin homology domain containing, family B (evectins) member 2
naked mole-rat(101715021) pleckstrin homology domain containing, family B (evectins) member 2
Zebrafish(100003431) pleckstrin homology domain containing, family B (evectins) member 2
domestic cat(101090283) pleckstrin homology domain containing, family B (evectins) member 2
dog(483858) pleckstrin homology domain-containing family B member 2-like
chicken(424758) pleckstrin homology domain containing, family B (evectins) member 2
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017958 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031706 Rosetta Predictions human pricing
NM_001100623 Rosetta Predictions human pricing
NM_017958 Rosetta Predictions human pricing
NM_001106899 Rosetta Predictions rat pricing
NM_145516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238155 predicted 230
2 SASI_Hs01_00238156 predicted 333
3 SASI_Hs01_00238157 predicted 346
4 SASI_Hs01_00238158 predicted 363
5 SASI_Hs01_00238159 predicted 417
6 SASI_Hs01_00238160 predicted 342
7 SASI_Hs01_00238161 predicted 199
8 SASI_Hs01_00238162 predicted 385
9 SASI_Hs01_00238163 predicted 398
10 SASI_Hs01_00238164 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322294 predicted 694
2 SASI_Hs02_00322295 predicted 1523
3 SASI_Hs02_00322296 predicted 1565
4 SASI_Hs02_00322297 predicted 1660
5 SASI_Hs02_00322298 predicted 1652
6 SASI_Hs02_00322299 predicted 1516
7 SASI_Hs02_00322300 predicted 647
8 SASI_Hs02_00322301 predicted 1558
9 SASI_Hs02_00322302 predicted 704
10 SASI_Hs02_00322303 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350991 predicted 691
2 SASI_Hs02_00350992 predicted 1524
3 SASI_Hs02_00350993 predicted 1563
4 SASI_Hs02_00350994 predicted 1662
5 SASI_Hs02_00350995 predicted 1646
6 SASI_Hs01_00038808 predicted 1512
7 SASI_Hs02_00350996 predicted 644
8 SASI_Hs02_00350997 predicted 1550
9 SASI_Hs02_00350998 predicted 701
10 SASI_Hs01_00038812 predicted 687
11 SASI_Hs01_00038805 predicted 772
12 SASI_Hs01_00038806 predicted 860
13 SASI_Hs01_00038807 predicted 993
14 SASI_Hs01_00038809 predicted 490
15 SASI_Hs01_00038810 predicted 901
16 SASI_Hs01_00038811 predicted 620
17 SASI_Hs01_00038813 predicted 402
18 SASI_Hs01_00038814 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223506 predicted 794
2 SASI_Rn02_00223507 predicted 972
3 SASI_Rn02_00223508 predicted 826
4 SASI_Rn02_00223509 predicted 840
5 SASI_Rn02_00223510 predicted 1045
6 SASI_Rn02_00223511 predicted 794
7 SASI_Rn02_00223512 predicted 743
8 SASI_Rn02_00223513 predicted 927
9 SASI_Rn02_00223514 predicted 378
10 SASI_Rn02_00223515 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119035 predicted 892
2 SASI_Mm01_00119036 predicted 853
3 SASI_Mm01_00119037 predicted 980
4 SASI_Mm01_00119038 predicted 1035
5 SASI_Mm02_00340984 predicted 1053
6 SASI_Mm01_00119039 predicted 864
7 SASI_Mm01_00119040 predicted 804
8 SASI_Mm02_00340985 predicted 767
9 SASI_Mm01_00119042 predicted 390
10 SASI_Mm01_00119043 predicted 631
11 SASI_Mm01_00119041 predicted 1030
12 SASI_Mm01_00119044 predicted 1222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017958
VALIDATED
PLEKHB2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family B (evectins) member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017958.1-154s1c1
Sequence:CCGGCGGATGGTCACCTGATCTATTCTCGAGAATAGATCAGGTGACCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017958.1-530s1c1
Sequence:CCGGGCCAGGAACTCAAGTTGTCTACTCGAGTAGACAACTTGAGTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017958.1-540s1c1
Sequence:CCGGCAAGTTGTCTACGCTGCGAATCTCGAGATTCGCAGCGTAGACAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017958.1-123s1c1
Sequence:CCGGCGCTGGAAGAAGAACTGGTTTCTCGAGAAACCAGTTCTTCTTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017958.1-1437s1c1
Sequence:CCGGCCTGAGAGTTTGAGGGCTTTACTCGAGTAAAGCCCTCAAACTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_017958.1-882s1c1
Sequence:CCGGCCACATAAGTACCACAGAGAACTCGAGTTCTCTGTGGTACTTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017958.1-618s1c1
Sequence:CCGGCCTGCTAACCAAGTCATCATTCTCGAGAATGATGACTTGGTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_017958.2-1107s21c1
Sequence:CCGGCCTGCTAACCAAGTCATCATTCTCGAGAATGATGACTTGGTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017958.2-645s21c1
Sequence:CCGGGATGGTCACCTGATCTATTATCTCGAGATAATAGATCAGGTGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017958.2-677s21c1
Sequence:CCGGTCGGCAGAATATCGAGGATAACTCGAGTTATCCTCGATATTCTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281962    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_017958.2-1926s21c1
Sequence:CCGGCCTGAGAGTTTGAGGGCTTTACTCGAGTAAAGCCCTCAAACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017958
VALIDATED
PLEKHB2 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family B (evectins) member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017958.1-154s1c1
Sequence:CCGGCGGATGGTCACCTGATCTATTCTCGAGAATAGATCAGGTGACCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017958.1-530s1c1
Sequence:CCGGGCCAGGAACTCAAGTTGTCTACTCGAGTAGACAACTTGAGTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017958.1-540s1c1
Sequence:CCGGCAAGTTGTCTACGCTGCGAATCTCGAGATTCGCAGCGTAGACAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017958.1-123s1c1
Sequence:CCGGCGCTGGAAGAAGAACTGGTTTCTCGAGAAACCAGTTCTTCTTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017958.1-1437s1c1
Sequence:CCGGCCTGAGAGTTTGAGGGCTTTACTCGAGTAAAGCCCTCAAACTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_017958.1-882s1c1
Sequence:CCGGCCACATAAGTACCACAGAGAACTCGAGTTCTCTGTGGTACTTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017958.1-618s1c1
Sequence:CCGGCCTGCTAACCAAGTCATCATTCTCGAGAATGATGACTTGGTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_017958.2-1107s21c1
Sequence:CCGGCCTGCTAACCAAGTCATCATTCTCGAGAATGATGACTTGGTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017958.2-645s21c1
Sequence:CCGGGATGGTCACCTGATCTATTATCTCGAGATAATAGATCAGGTGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017958.2-677s21c1
Sequence:CCGGTCGGCAGAATATCGAGGATAACTCGAGTTATCCTCGATATTCTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281962    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_017958.2-1926s21c1
Sequence:CCGGCCTGAGAGTTTGAGGGCTTTACTCGAGTAAAGCCCTCAAACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017958
VALIDATED
PLEKHB2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family B (evectins) member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017958.1-154s1c1
Sequence:CCGGCGGATGGTCACCTGATCTATTCTCGAGAATAGATCAGGTGACCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017958.1-530s1c1
Sequence:CCGGGCCAGGAACTCAAGTTGTCTACTCGAGTAGACAACTTGAGTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017958.1-540s1c1
Sequence:CCGGCAAGTTGTCTACGCTGCGAATCTCGAGATTCGCAGCGTAGACAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017958.1-123s1c1
Sequence:CCGGCGCTGGAAGAAGAACTGGTTTCTCGAGAAACCAGTTCTTCTTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017958.1-1437s1c1
Sequence:CCGGCCTGAGAGTTTGAGGGCTTTACTCGAGTAAAGCCCTCAAACTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_017958.1-882s1c1
Sequence:CCGGCCACATAAGTACCACAGAGAACTCGAGTTCTCTGTGGTACTTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017958.1-618s1c1
Sequence:CCGGCCTGCTAACCAAGTCATCATTCTCGAGAATGATGACTTGGTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_017958.2-1107s21c1
Sequence:CCGGCCTGCTAACCAAGTCATCATTCTCGAGAATGATGACTTGGTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017958.2-645s21c1
Sequence:CCGGGATGGTCACCTGATCTATTATCTCGAGATAATAGATCAGGTGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017958.2-677s21c1
Sequence:CCGGTCGGCAGAATATCGAGGATAACTCGAGTTATCCTCGATATTCTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281962    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_017958.2-1926s21c1
Sequence:CCGGCCTGAGAGTTTGAGGGCTTTACTCGAGTAAAGCCCTCAAACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145516
PLEKHB2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family B (evectins) member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145516.1-1868s1c1
Sequence:CCGGGCTCACAATCTGGCTTTCTAACTCGAGTTAGAAAGCCAGATTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145516.1-164s1c1
Sequence:CCGGCACCTGATCTACTACGATGATCTCGAGATCATCGTAGTAGATCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145516.1-199s1c1
Sequence:CCGGCATAGAGGATAAGGTCCACATCTCGAGATGTGGACCTTATCCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145516.1-364s1c1
Sequence:CCGGCCTGGCATGGAAGTTTACACTCTCGAGAGTGTAAACTTCCATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145516.1-532s1c1
Sequence:CCGGCGCAGGAACTCAAGTTGTCTACTCGAGTAGACAACTTGAGTTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145516.2-572s21c1
Sequence:CCGGCGCAGGAACTCAAGTTGTCTACTCGAGTAGACAACTTGAGTTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145516.2-239s21c1
Sequence:CCGGCATAGAGGATAAGGTCCACATCTCGAGATGTGGACCTTATCCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145516.2-404s21c1
Sequence:CCGGCCTGGCATGGAAGTTTACACTCTCGAGAGTGTAAACTTCCATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145516.2-204s21c1
Sequence:CCGGCACCTGATCTACTACGATGATCTCGAGATCATCGTAGTAGATCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145516
PLEKHB2 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family B (evectins) member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145516.1-1868s1c1
Sequence:CCGGGCTCACAATCTGGCTTTCTAACTCGAGTTAGAAAGCCAGATTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145516.1-164s1c1
Sequence:CCGGCACCTGATCTACTACGATGATCTCGAGATCATCGTAGTAGATCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145516.1-199s1c1
Sequence:CCGGCATAGAGGATAAGGTCCACATCTCGAGATGTGGACCTTATCCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145516.1-364s1c1
Sequence:CCGGCCTGGCATGGAAGTTTACACTCTCGAGAGTGTAAACTTCCATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145516.1-532s1c1
Sequence:CCGGCGCAGGAACTCAAGTTGTCTACTCGAGTAGACAACTTGAGTTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145516.2-572s21c1
Sequence:CCGGCGCAGGAACTCAAGTTGTCTACTCGAGTAGACAACTTGAGTTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145516.2-239s21c1
Sequence:CCGGCATAGAGGATAAGGTCCACATCTCGAGATGTGGACCTTATCCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145516.2-404s21c1
Sequence:CCGGCCTGGCATGGAAGTTTACACTCTCGAGAGTGTAAACTTCCATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145516.2-204s21c1
Sequence:CCGGCACCTGATCTACTACGATGATCTCGAGATCATCGTAGTAGATCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145516
PLEKHB2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family B (evectins) member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145516.1-1868s1c1
Sequence:CCGGGCTCACAATCTGGCTTTCTAACTCGAGTTAGAAAGCCAGATTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145516.1-164s1c1
Sequence:CCGGCACCTGATCTACTACGATGATCTCGAGATCATCGTAGTAGATCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145516.1-199s1c1
Sequence:CCGGCATAGAGGATAAGGTCCACATCTCGAGATGTGGACCTTATCCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145516.1-364s1c1
Sequence:CCGGCCTGGCATGGAAGTTTACACTCTCGAGAGTGTAAACTTCCATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145516.1-532s1c1
Sequence:CCGGCGCAGGAACTCAAGTTGTCTACTCGAGTAGACAACTTGAGTTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145516.2-572s21c1
Sequence:CCGGCGCAGGAACTCAAGTTGTCTACTCGAGTAGACAACTTGAGTTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145516.2-239s21c1
Sequence:CCGGCATAGAGGATAAGGTCCACATCTCGAGATGTGGACCTTATCCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145516.2-404s21c1
Sequence:CCGGCCTGGCATGGAAGTTTACACTCTCGAGAGTGTAAACTTCCATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145516.2-204s21c1
Sequence:CCGGCACCTGATCTACTACGATGATCTCGAGATCATCGTAGTAGATCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks