EMAIL THIS PAGE TO A FRIEND

PLEKHF2

pleckstrin homology domain containing, family F (with FYVE domain) member 2

Synonyms: EAPF PHAFIN2 ZFYVE18
UniProtKB ID: Q9H8W4
Gene ID:
Mouse(71801) pleckstrin homology domain containing, family F (with FYVE domain) member 2
Rat(362484) pleckstrin homology domain containing, family F (with FYVE domain) member 2
Zebrafish(393214) pleckstrin homology domain containing, family F (with FYVE domain) member 2
chicken(420234) pleckstrin homology domain containing, family F (with FYVE domain) member 2
domestic guinea pig(100728020) pleckstrin homology domain containing, family F (with FYVE domain) member 2
cow(782597) pleckstrin homology domain containing, family F (with FYVE domain) member 2
sheep(101108841) pleckstrin homology domain containing, family F (with FYVE domain) member 2
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024613 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024613 Rosetta Predictions human pricing
NM_001108655 Rosetta Predictions rat pricing
NM_175175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039736 predicted 846
2 SASI_Hs01_00039737 predicted 492
3 SASI_Hs01_00039738 predicted 526
4 SASI_Hs01_00039740 predicted 832
5 SASI_Hs01_00039741 predicted 502
6 SASI_Hs01_00039742 predicted 996
7 SASI_Hs01_00039743 predicted 706
8 SASI_Hs02_00356981 predicted 601
9 SASI_Hs01_00039744 predicted 932
10 SASI_Hs02_00356982 predicted 1022
11 SASI_Hs01_00039735 predicted 1101
12 SASI_Hs01_00039739 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240769 predicted 417
2 SASI_Rn02_00240770 predicted 555
3 SASI_Rn02_00240771 predicted 849
4 SASI_Rn02_00240772 predicted 764
5 SASI_Rn02_00240773 predicted 265
6 SASI_Rn02_00240774 predicted 631
7 SASI_Rn02_00240775 predicted 539
8 SASI_Rn02_00240776 predicted 827
9 SASI_Rn02_00240777 predicted 345
10 SASI_Rn02_00240778 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079989 predicted 491
2 SASI_Mm01_00079990 predicted 777
3 SASI_Mm01_00079991 predicted 1006
4 SASI_Mm01_00079992 predicted 567
5 SASI_Mm01_00079993 predicted 475
6 SASI_Mm01_00079994 predicted 928
7 SASI_Mm01_00079995 predicted 213
8 SASI_Mm01_00079996 predicted 429
9 SASI_Mm01_00079997 predicted 844
10 SASI_Mm02_00345818 predicted 675
11 SASI_Mm01_00079998 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175175
VALIDATED
PLEKHF2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family F (with FYVE domain) member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175175.3-911s1c1
Sequence:CCGGCGATGATGATAGCAGTGACTACTCGAGTAGTCACTGCTATCATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175175.3-469s21c1
Sequence:CCGGTACGGAATGGATGGCTTATTACTCGAGTAATAAGCCATCCATTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175175.3-363s21c1
Sequence:CCGGATTCTAGTATACGGCAATATTCTCGAGAATATTGCCGTATACTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175175.3-869s1c1
Sequence:CCGGGTCGTTGAAGTCTCCTTTAAACTCGAGTTTAAAGGAGACTTCAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175175.3-543s1c1
Sequence:CCGGGAGTGGATGAATCACATAAATCTCGAGATTTATGTGATTCATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175175.3-843s21c1
Sequence:CCGGCCGACTAGATCAGACTCTTATCTCGAGATAAGAGTCTGATCTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175175.3-208s21c1
Sequence:CCGGAGGCGAATACTAGACGCATAACTCGAGTTATGCGTCTAGTATTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175175.3-1489s21c1
Sequence:CCGGTGGATATAGGTAAGCATATTTCTCGAGAAATATGCTTACCTATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175175
VALIDATED
PLEKHF2 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family F (with FYVE domain) member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175175.3-911s1c1
Sequence:CCGGCGATGATGATAGCAGTGACTACTCGAGTAGTCACTGCTATCATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175175.3-469s21c1
Sequence:CCGGTACGGAATGGATGGCTTATTACTCGAGTAATAAGCCATCCATTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175175.3-363s21c1
Sequence:CCGGATTCTAGTATACGGCAATATTCTCGAGAATATTGCCGTATACTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175175.3-869s1c1
Sequence:CCGGGTCGTTGAAGTCTCCTTTAAACTCGAGTTTAAAGGAGACTTCAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175175.3-543s1c1
Sequence:CCGGGAGTGGATGAATCACATAAATCTCGAGATTTATGTGATTCATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175175.3-843s21c1
Sequence:CCGGCCGACTAGATCAGACTCTTATCTCGAGATAAGAGTCTGATCTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175175.3-208s21c1
Sequence:CCGGAGGCGAATACTAGACGCATAACTCGAGTTATGCGTCTAGTATTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175175.3-1489s21c1
Sequence:CCGGTGGATATAGGTAAGCATATTTCTCGAGAAATATGCTTACCTATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175175
VALIDATED
PLEKHF2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family F (with FYVE domain) member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175175.3-911s1c1
Sequence:CCGGCGATGATGATAGCAGTGACTACTCGAGTAGTCACTGCTATCATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175175.3-469s21c1
Sequence:CCGGTACGGAATGGATGGCTTATTACTCGAGTAATAAGCCATCCATTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175175.3-363s21c1
Sequence:CCGGATTCTAGTATACGGCAATATTCTCGAGAATATTGCCGTATACTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175175.3-869s1c1
Sequence:CCGGGTCGTTGAAGTCTCCTTTAAACTCGAGTTTAAAGGAGACTTCAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175175.3-543s1c1
Sequence:CCGGGAGTGGATGAATCACATAAATCTCGAGATTTATGTGATTCATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175175.3-843s21c1
Sequence:CCGGCCGACTAGATCAGACTCTTATCTCGAGATAAGAGTCTGATCTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175175.3-208s21c1
Sequence:CCGGAGGCGAATACTAGACGCATAACTCGAGTTATGCGTCTAGTATTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175175.3-1489s21c1
Sequence:CCGGTGGATATAGGTAAGCATATTTCTCGAGAAATATGCTTACCTATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024613
VALIDATED
PLEKHF2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family F (with FYVE domain) member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024613.2-930s1c1
Sequence:CCGGGCCAGTCATTGAAGTCTCCTTCTCGAGAAGGAGACTTCAATGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024613.2-532s1c1
Sequence:CCGGCTTAAGGAATGGATGGCTAATCTCGAGATTAGCCATCCATTCCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024613.2-1105s1c1
Sequence:CCGGCCTGAGAAACTTGTAACCTATCTCGAGATAGGTTACAAGTTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024613.2-851s1c1
Sequence:CCGGCGGATTTGTGACTTCTGCTATCTCGAGATAGCAGAAGTCACAAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024613.2-2366s1c1
Sequence:CCGGGCTGCAAACAACTACAGTCTTCTCGAGAAGACTGTAGTTGTTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024613.2-720s1c1
Sequence:CCGGGTATGCGTTGTCAGAAAGCAACTCGAGTTGCTTTCTGACAACGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024613.2-851s21c1
Sequence:CCGGCGGATTTGTGACTTCTGCTATCTCGAGATAGCAGAAGTCACAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024613.2-274s21c1
Sequence:CCGGAGCAAATACTAGACGTATAAGCTCGAGCTTATACGTCTAGTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024613.2-1105s21c1
Sequence:CCGGCCTGAGAAACTTGTAACCTATCTCGAGATAGGTTACAAGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024613.2-532s21c1
Sequence:CCGGCTTAAGGAATGGATGGCTAATCTCGAGATTAGCCATCCATTCCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024613.2-429s21c1
Sequence:CCGGTTCTTGTATATGGCAATATTGCTCGAGCAATATTGCCATATACAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024613
VALIDATED
PLEKHF2 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family F (with FYVE domain) member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024613.2-930s1c1
Sequence:CCGGGCCAGTCATTGAAGTCTCCTTCTCGAGAAGGAGACTTCAATGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024613.2-532s1c1
Sequence:CCGGCTTAAGGAATGGATGGCTAATCTCGAGATTAGCCATCCATTCCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024613.2-1105s1c1
Sequence:CCGGCCTGAGAAACTTGTAACCTATCTCGAGATAGGTTACAAGTTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024613.2-851s1c1
Sequence:CCGGCGGATTTGTGACTTCTGCTATCTCGAGATAGCAGAAGTCACAAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024613.2-2366s1c1
Sequence:CCGGGCTGCAAACAACTACAGTCTTCTCGAGAAGACTGTAGTTGTTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024613.2-720s1c1
Sequence:CCGGGTATGCGTTGTCAGAAAGCAACTCGAGTTGCTTTCTGACAACGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024613.2-851s21c1
Sequence:CCGGCGGATTTGTGACTTCTGCTATCTCGAGATAGCAGAAGTCACAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024613.2-274s21c1
Sequence:CCGGAGCAAATACTAGACGTATAAGCTCGAGCTTATACGTCTAGTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024613.2-1105s21c1
Sequence:CCGGCCTGAGAAACTTGTAACCTATCTCGAGATAGGTTACAAGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024613.2-532s21c1
Sequence:CCGGCTTAAGGAATGGATGGCTAATCTCGAGATTAGCCATCCATTCCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024613.2-429s21c1
Sequence:CCGGTTCTTGTATATGGCAATATTGCTCGAGCAATATTGCCATATACAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024613
VALIDATED
PLEKHF2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family F (with FYVE domain) member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024613.2-930s1c1
Sequence:CCGGGCCAGTCATTGAAGTCTCCTTCTCGAGAAGGAGACTTCAATGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024613.2-532s1c1
Sequence:CCGGCTTAAGGAATGGATGGCTAATCTCGAGATTAGCCATCCATTCCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024613.2-1105s1c1
Sequence:CCGGCCTGAGAAACTTGTAACCTATCTCGAGATAGGTTACAAGTTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024613.2-851s1c1
Sequence:CCGGCGGATTTGTGACTTCTGCTATCTCGAGATAGCAGAAGTCACAAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024613.2-2366s1c1
Sequence:CCGGGCTGCAAACAACTACAGTCTTCTCGAGAAGACTGTAGTTGTTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024613.2-720s1c1
Sequence:CCGGGTATGCGTTGTCAGAAAGCAACTCGAGTTGCTTTCTGACAACGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024613.2-851s21c1
Sequence:CCGGCGGATTTGTGACTTCTGCTATCTCGAGATAGCAGAAGTCACAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024613.2-274s21c1
Sequence:CCGGAGCAAATACTAGACGTATAAGCTCGAGCTTATACGTCTAGTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024613.2-1105s21c1
Sequence:CCGGCCTGAGAAACTTGTAACCTATCTCGAGATAGGTTACAAGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024613.2-532s21c1
Sequence:CCGGCTTAAGGAATGGATGGCTAATCTCGAGATTAGCCATCCATTCCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024613.2-429s21c1
Sequence:CCGGTTCTTGTATATGGCAATATTGCTCGAGCAATATTGCCATATACAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks