EMAIL THIS PAGE TO A FRIEND

PLEKHM3

pleckstrin homology domain containing, family M, member 3

Synonyms: DAPR PLEKHM1L
UniProtKB ID: Q6ZWE6, B9EKV2, Q8WW68
Gene ID:
Mouse(241075) pleckstrin homology domain containing, family M, member 3
Rat(316455) pleckstrin homology domain containing, family M, member 3
cow(533312) pleckstrin homology domain containing, family M, member 3
sheep(101119021) pleckstrin homology domain containing, family M, member 3
naked mole-rat(101708089) pleckstrin homology domain containing, family M, member 3
Domestic Rabbit(100357735) pleckstrin homology domain containing, family M, member 3
domestic guinea pig(100728630) pleckstrin homology domain containing, family M, member 3
Zebrafish(571507) pleckstrin homology domain containing, family M, member 3
chicken(424092) pleckstrin homology domain containing, family M, member 3
dog(478888) pleckstrin homology domain containing, family M, member 3
Horse(100069132) pleckstrin homology domain containing, family M, member 3
domestic cat(101092385) pleckstrin homology domain containing, family M, member 3
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035046 Anti-PLEKHM3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500284 Anti-PLEKHM3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2900860 Anti-PLEKHM3 antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080475 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080475 Rosetta Predictions human pricing
XM_371591 Rosetta Predictions human pricing
XM_934660 Rosetta Predictions human pricing
XM_001072167 Rosetta Predictions rat pricing
XM_237212 Rosetta Predictions rat pricing
NM_001039493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315196 predicted 1920
2 SASI_Hs02_00315197 predicted 1620
3 SASI_Hs02_00315198 predicted 1017
4 SASI_Hs02_00315199 predicted 2038
5 SASI_Hs02_00315200 predicted 234
6 SASI_Hs02_00315201 predicted 1125
7 SASI_Hs02_00315202 predicted 1204
8 SASI_Hs02_00315203 predicted 1007
9 SASI_Hs02_00315204 predicted 1416
10 SASI_Hs02_00315205 predicted 1580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253399 predicted 480
2 SASI_Hs01_00253400 predicted 2394
3 SASI_Hs01_00253401 predicted 2041
4 SASI_Hs01_00253402 predicted 1445
5 SASI_Hs01_00253403 predicted 656
6 SASI_Hs01_00253404 predicted 1548
7 SASI_Hs01_00253405 predicted 1632
8 SASI_Hs01_00253406 predicted 1436
9 SASI_Hs01_00253407 predicted 2002
10 SASI_Hs01_00253408 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255611 predicted 404
2 SASI_Hs01_00255612 predicted 362
3 SASI_Hs01_00255613 predicted 361
4 SASI_Hs01_00255614 predicted 369
5 SASI_Hs01_00255615 predicted 373
6 SASI_Hs01_00255616 predicted 402
7 SASI_Hs01_00255617 predicted 365
8 SASI_Hs01_00255618 predicted 409
9 SASI_Hs01_00255619 predicted 366
10 SASI_Hs01_00255620 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338088 predicted 293
2 SASI_Rn02_00338089 predicted 1261
3 SASI_Rn02_00338090 predicted 1520
4 SASI_Rn02_00338091 predicted 2626
5 SASI_Rn02_00338092 predicted 995
6 SASI_Rn02_00338093 predicted 2082
7 SASI_Rn02_00338094 predicted 2155
8 SASI_Rn02_00338095 predicted 407
9 SASI_Rn02_00338096 predicted 326
10 SASI_Rn02_00338097 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390737 predicted 289
2 SASI_Rn02_00390738 predicted 1257
3 SASI_Rn02_00390739 predicted 1522
4 SASI_Rn02_00390740 predicted 1402
5 SASI_Rn02_00390741 predicted 1775
6 SASI_Rn02_00390742 predicted 997
7 SASI_Rn02_00390743 predicted 1161
8 SASI_Rn02_00390744 predicted 995
9 SASI_Rn02_00390745 predicted 329
10 SASI_Rn02_00390746 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110478 predicted 2643
2 SASI_Mm01_00110479 predicted 391
3 SASI_Mm01_00110480 predicted 2393
4 SASI_Mm01_00110481 predicted 2715
5 SASI_Mm01_00110482 predicted 2609
6 SASI_Mm01_00110483 predicted 1342
7 SASI_Mm01_00110484 predicted 1487
8 SASI_Mm01_00110485 predicted 1358
9 SASI_Mm01_00110486 predicted 402
10 SASI_Mm01_00110487 predicted 1908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080475
PLEKHM3 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family M, member 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080475.2-2083s21c1
Sequence:CCGGCAACTACAGTGGGTGGTATTACTCGAGTAATACCACCCACTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080475.2-5122s21c1
Sequence:CCGGCCGAGAGTCAAGGGCGAAATTCTCGAGAATTTCGCCCTTGACTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080475.2-933s21c1
Sequence:CCGGCTCGATCACGATCAGATATTACTCGAGTAATATCTGATCGTGATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080475.2-633s21c1
Sequence:CCGGATGAGGTACTCAGTAACATAACTCGAGTTATGTTACTGAGTACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080475
PLEKHM3 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family M, member 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080475.2-2083s21c1
Sequence:CCGGCAACTACAGTGGGTGGTATTACTCGAGTAATACCACCCACTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080475.2-5122s21c1
Sequence:CCGGCCGAGAGTCAAGGGCGAAATTCTCGAGAATTTCGCCCTTGACTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080475.2-933s21c1
Sequence:CCGGCTCGATCACGATCAGATATTACTCGAGTAATATCTGATCGTGATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080475.2-633s21c1
Sequence:CCGGATGAGGTACTCAGTAACATAACTCGAGTTATGTTACTGAGTACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080475
PLEKHM3 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family M, member 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080475.2-2083s21c1
Sequence:CCGGCAACTACAGTGGGTGGTATTACTCGAGTAATACCACCCACTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080475.2-5122s21c1
Sequence:CCGGCCGAGAGTCAAGGGCGAAATTCTCGAGAATTTCGCCCTTGACTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080475.2-933s21c1
Sequence:CCGGCTCGATCACGATCAGATATTACTCGAGTAATATCTGATCGTGATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080475.2-633s21c1
Sequence:CCGGATGAGGTACTCAGTAACATAACTCGAGTTATGTTACTGAGTACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175509
VALIDATED
PLEKHM3 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family M, member 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175509.3-1509s1c1
Sequence:CCGGGCTGAGCAAGGCCTATCTTATCTCGAGATAAGATAGGCCTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175509.3-2415s1c1
Sequence:CCGGGATCTGTAACAACGGCGAGATCTCGAGATCTCGCCGTTGTTACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175509.3-3985s1c1
Sequence:CCGGGCAGCATCATTAGAAACTATACTCGAGTATAGTTTCTAATGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175509.3-1914s1c1
Sequence:CCGGGCGATCTATTGGTCTCTCTAACTCGAGTTAGAGAGACCAATAGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175509
VALIDATED
PLEKHM3 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family M, member 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175509.3-1509s1c1
Sequence:CCGGGCTGAGCAAGGCCTATCTTATCTCGAGATAAGATAGGCCTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175509.3-2415s1c1
Sequence:CCGGGATCTGTAACAACGGCGAGATCTCGAGATCTCGCCGTTGTTACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175509.3-3985s1c1
Sequence:CCGGGCAGCATCATTAGAAACTATACTCGAGTATAGTTTCTAATGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175509.3-1914s1c1
Sequence:CCGGGCGATCTATTGGTCTCTCTAACTCGAGTTAGAGAGACCAATAGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175509
VALIDATED
PLEKHM3 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family M, member 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175509.3-1509s1c1
Sequence:CCGGGCTGAGCAAGGCCTATCTTATCTCGAGATAAGATAGGCCTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175509.3-2415s1c1
Sequence:CCGGGATCTGTAACAACGGCGAGATCTCGAGATCTCGCCGTTGTTACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175509.3-3985s1c1
Sequence:CCGGGCAGCATCATTAGAAACTATACTCGAGTATAGTTTCTAATGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175509.3-1914s1c1
Sequence:CCGGGCGATCTATTGGTCTCTCTAACTCGAGTTAGAGAGACCAATAGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks