EMAIL THIS PAGE TO A FRIEND

PLG

plasminogen

UniProtKB ID: P00747, Q15146, Q5TEH4, Q6PA00
Gene ID:
Human(5340) Summary: The protein encoded by this gene is a secreted blood zymogen that is activated by proteolysis and converted to plasmin and angiostatin. Plasmin dissolves fibrin in blood clots and is an important protease in many other cellular processes while angiostatin inhibits angiogenesis. Defects in this gene are likely a cause of thrombophilia and ligneous conjunctivitis. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]
Mouse(18815) plasminogen
Rat(85253) plasminogen
Zebrafish(322691) plasminogen
chicken(421580) plasminogen
dog(403602) plasminogen
cow(280897) plasminogen
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000301 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000301 Rosetta Predictions human pricing
NM_053491 Rosetta Predictions rat pricing
NM_008877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200788 predicted 709
2 SASI_Hs01_00200789 predicted 2123
3 SASI_Hs02_00302286 predicted 920
4 SASI_Hs01_00200791 predicted 861
5 SASI_Hs01_00200792 predicted 1135
6 SASI_Hs01_00200794 predicted 604
7 SASI_Hs01_00200795 predicted 1493
8 SASI_Hs01_00200787 predicted 1777
9 SASI_Hs01_00200790 predicted 538
10 SASI_Hs01_00200793 predicted 914
11 SASI_Hs01_00200796 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266089 predicted 2104
2 SASI_Rn02_00266090 predicted 1233
3 SASI_Rn02_00266091 predicted 247
4 SASI_Rn02_00266092 predicted 1990
5 SASI_Rn02_00266093 predicted 1821
6 SASI_Rn02_00266094 predicted 1926
7 SASI_Rn02_00266095 predicted 709
8 SASI_Rn02_00266096 predicted 2252
9 SASI_Rn02_00266097 predicted 1847
10 SASI_Rn02_00266098 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060942 predicted 230
2 SASI_Mm01_00060943 predicted 1845
3 SASI_Mm01_00060944 predicted 2184
4 SASI_Mm01_00060945 predicted 1997
5 SASI_Mm01_00060946 predicted 580
6 SASI_Mm01_00060947 predicted 1501
7 SASI_Mm01_00060948 predicted 2518
8 SASI_Mm01_00060949 predicted 1094
9 SASI_Mm01_00060950 predicted 2131
10 SASI_Mm02_00314867 predicted 1924
11 SASI_Mm01_00060951 predicted 1883
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008877
PLG MISSION shRNA Bacterial Glycerol Stock
plasminogen
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-1841s1c1
Sequence:CCGGCCTGGCAAATCAGCCTTAGAACTCGAGTTCTAAGGCTGATTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-1928s1c1
Sequence:CCGGCCCACTGTTTGGAGAAATCTTCTCGAGAAGATTTCTCCAAACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-720s1c1
Sequence:CCGGCCCTGCCAAATTTCCAAGCAACTCGAGTTGCTTGGAAATTTGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-875s1c1
Sequence:CCGGCCTACCAATGTCTGAAAGGAACTCGAGTTCCTTTCAGACATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-2226s1c1
Sequence:CCGGGCTGCCTGTGATTGAGAACAACTCGAGTTGTTCTCAATCACAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008877
PLG MISSION shRNA shRNA Plasmid DNA
plasminogen
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-1841s1c1
Sequence:CCGGCCTGGCAAATCAGCCTTAGAACTCGAGTTCTAAGGCTGATTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-1928s1c1
Sequence:CCGGCCCACTGTTTGGAGAAATCTTCTCGAGAAGATTTCTCCAAACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-720s1c1
Sequence:CCGGCCCTGCCAAATTTCCAAGCAACTCGAGTTGCTTGGAAATTTGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-875s1c1
Sequence:CCGGCCTACCAATGTCTGAAAGGAACTCGAGTTCCTTTCAGACATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-2226s1c1
Sequence:CCGGGCTGCCTGTGATTGAGAACAACTCGAGTTGTTCTCAATCACAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008877
PLG MISSION shRNA Lentiviral Transduction Particles
plasminogen
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-1841s1c1
Sequence:CCGGCCTGGCAAATCAGCCTTAGAACTCGAGTTCTAAGGCTGATTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-1928s1c1
Sequence:CCGGCCCACTGTTTGGAGAAATCTTCTCGAGAAGATTTCTCCAAACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-720s1c1
Sequence:CCGGCCCTGCCAAATTTCCAAGCAACTCGAGTTGCTTGGAAATTTGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-875s1c1
Sequence:CCGGCCTACCAATGTCTGAAAGGAACTCGAGTTCCTTTCAGACATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008877.2-2226s1c1
Sequence:CCGGGCTGCCTGTGATTGAGAACAACTCGAGTTGTTCTCAATCACAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000301
PLG MISSION shRNA Bacterial Glycerol Stock
plasminogen
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000301.1-2554s1c1
Sequence:CCGGGCTGGAAATAACTGGCAGTAACTCGAGTTACTGCCAGTTATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000301.1-1119s1c1
Sequence:CCGGCCCAGTATCCACGGAACAATTCTCGAGAATTGTTCCGTGGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000301.1-2214s1c1
Sequence:CCGGGCTCCCTGTGATTGAGAATAACTCGAGTTATTCTCAATCACAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000301.1-538s1c1
Sequence:CCGGCCCTGGTGCTATACTACTGATCTCGAGATCAGTAGTATAGCACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000301.1-1981s1c1
Sequence:CCGGGTGAATCTCGAACCGCATGTTCTCGAGAACATGCGGTTCGAGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000301.2-704s21c1
Sequence:CCGGCACACGCTCATGGATACATTCCTCGAGGAATGTATCCATGAGCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000301.2-813s21c1
Sequence:CCGGCAACAAGCGCTGGGAACTTTGCTCGAGCAAAGTTCCCAGCGCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000301
PLG MISSION shRNA shRNA Plasmid DNA
plasminogen
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000301.1-2554s1c1
Sequence:CCGGGCTGGAAATAACTGGCAGTAACTCGAGTTACTGCCAGTTATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000301.1-1119s1c1
Sequence:CCGGCCCAGTATCCACGGAACAATTCTCGAGAATTGTTCCGTGGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000301.1-2214s1c1
Sequence:CCGGGCTCCCTGTGATTGAGAATAACTCGAGTTATTCTCAATCACAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000301.1-538s1c1
Sequence:CCGGCCCTGGTGCTATACTACTGATCTCGAGATCAGTAGTATAGCACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000301.1-1981s1c1
Sequence:CCGGGTGAATCTCGAACCGCATGTTCTCGAGAACATGCGGTTCGAGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000301.2-704s21c1
Sequence:CCGGCACACGCTCATGGATACATTCCTCGAGGAATGTATCCATGAGCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000301.2-813s21c1
Sequence:CCGGCAACAAGCGCTGGGAACTTTGCTCGAGCAAAGTTCCCAGCGCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000301
PLG MISSION shRNA Lentiviral Transduction Particles
plasminogen
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000301.1-2554s1c1
Sequence:CCGGGCTGGAAATAACTGGCAGTAACTCGAGTTACTGCCAGTTATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000301.1-1119s1c1
Sequence:CCGGCCCAGTATCCACGGAACAATTCTCGAGAATTGTTCCGTGGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000301.1-2214s1c1
Sequence:CCGGGCTCCCTGTGATTGAGAATAACTCGAGTTATTCTCAATCACAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000301.1-538s1c1
Sequence:CCGGCCCTGGTGCTATACTACTGATCTCGAGATCAGTAGTATAGCACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000301.1-1981s1c1
Sequence:CCGGGTGAATCTCGAACCGCATGTTCTCGAGAACATGCGGTTCGAGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000301.2-704s21c1
Sequence:CCGGCACACGCTCATGGATACATTCCTCGAGGAATGTATCCATGAGCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000301.2-813s21c1
Sequence:CCGGCAACAAGCGCTGGGAACTTTGCTCGAGCAAAGTTCCCAGCGCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks