EMAIL THIS PAGE TO A FRIEND

PLIN1

perilipin 1

Synonyms: FPLD4 PERI PLIN
UniProtKB ID: O60240, Q8N5Y6
Gene ID:
Human(5346) Summary: The protein encoded by this gene coats lipid storage droplets in adipocytes, thereby protecting them until they can be broken down by hormone-sensitive lipase. The encoded protein is the major cAMP-dependent protein kinase substrate in adipocytes and, when unphosphorylated, may play a role in the inhibition of lipolysis. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Feb 2009]
Mouse(103968) perilipin 1
Rat(25629) perilipin 1
Zebrafish(100034463) perilipin 1
chicken(415487) perilipin 1
dog(488735) perilipin 1
cow(520598) perilipin 1
sheep(100135431) perilipin 1
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175640 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175640 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175640 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002666 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002666 Rosetta Predictions human pricing
NM_013094 Rosetta Predictions rat pricing
NM_001113471 Rosetta Predictions mouse pricing
NM_175640 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178945 predicted 589
2 SASI_Hs01_00178946 predicted 270
3 SASI_Hs01_00178947 predicted 652
4 SASI_Hs01_00178948 predicted 365
5 SASI_Hs01_00178949 predicted 603
6 SASI_Hs01_00178950 predicted 276
7 SASI_Hs01_00178951 predicted 235
8 SASI_Hs01_00178953 predicted 792
9 SASI_Hs01_00178954 predicted 1362
10 SASI_Hs02_00334231 predicted 1643
11 SASI_Hs01_00178952 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059668 predicted 1334
2 SASI_Rn01_00059669 predicted 328
3 SASI_Rn01_00059670 predicted 204
4 SASI_Rn01_00059671 predicted 759
5 SASI_Rn01_00059672 predicted 452
6 SASI_Rn01_00059673 predicted 1251
7 SASI_Rn01_00059675 predicted 238
8 SASI_Rn01_00059676 predicted 1272
9 SASI_Rn01_00059677 predicted 1331
10 SASI_Rn02_00260861 predicted 626
11 SASI_Rn01_00059674 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307953 predicted 1206
2 SASI_Mm02_00307954 predicted 1586
3 SASI_Mm02_00307955 predicted 1295
4 SASI_Mm02_00307956 predicted 1232
5 SASI_Mm02_00307957 predicted 722
6 SASI_Mm02_00307958 predicted 449
7 SASI_Mm02_00307959 predicted 1224
8 SASI_Mm02_00307960 predicted 1623
9 SASI_Mm02_00307961 predicted 592
10 SASI_Mm02_00307962 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179095 predicted 1262
2 SASI_Mm01_00179096 predicted 1645
3 SASI_Mm01_00179097 predicted 1348
4 SASI_Mm01_00179098 predicted 1289
5 SASI_Mm01_00179099 predicted 771
6 SASI_Mm01_00179100 predicted 500
7 SASI_Mm01_00179101 predicted 1274
8 SASI_Mm02_00346565 predicted 1685
9 SASI_Mm01_00179102 predicted 645
10 SASI_Mm01_00179103 predicted 571
11 SASI_Mm01_00179104 predicted 1228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175640
PLIN1 MISSION shRNA Bacterial Glycerol Stock
perilipin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175640.1-1678s1c1
Sequence:CCGGCGAGGCACACATCATGTCTAACTCGAGTTAGACATGATGTGTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175640.1-1219s1c1
Sequence:CCGGGTAGACACTGTGGTACACTATCTCGAGATAGTGTACCACAGTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175640.1-712s1c1
Sequence:CCGGCTTTCTCGACACACCATGCAACTCGAGTTGCATGGTGTGTCGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175640.1-340s1c1
Sequence:CCGGGCTCTTCAATACCCTCCAGAACTCGAGTTCTGGAGGGTATTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175640.1-708s1c1
Sequence:CCGGCACTCTTTCTCGACACACCATCTCGAGATGGTGTGTCGAGAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175640
PLIN1 MISSION shRNA shRNA Plasmid DNA
perilipin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175640.1-1678s1c1
Sequence:CCGGCGAGGCACACATCATGTCTAACTCGAGTTAGACATGATGTGTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175640.1-1219s1c1
Sequence:CCGGGTAGACACTGTGGTACACTATCTCGAGATAGTGTACCACAGTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175640.1-712s1c1
Sequence:CCGGCTTTCTCGACACACCATGCAACTCGAGTTGCATGGTGTGTCGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175640.1-340s1c1
Sequence:CCGGGCTCTTCAATACCCTCCAGAACTCGAGTTCTGGAGGGTATTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175640.1-708s1c1
Sequence:CCGGCACTCTTTCTCGACACACCATCTCGAGATGGTGTGTCGAGAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175640
PLIN1 MISSION shRNA Lentiviral Transduction Particles
perilipin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175640.1-1678s1c1
Sequence:CCGGCGAGGCACACATCATGTCTAACTCGAGTTAGACATGATGTGTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175640.1-1219s1c1
Sequence:CCGGGTAGACACTGTGGTACACTATCTCGAGATAGTGTACCACAGTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175640.1-712s1c1
Sequence:CCGGCTTTCTCGACACACCATGCAACTCGAGTTGCATGGTGTGTCGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175640.1-340s1c1
Sequence:CCGGGCTCTTCAATACCCTCCAGAACTCGAGTTCTGGAGGGTATTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175640.1-708s1c1
Sequence:CCGGCACTCTTTCTCGACACACCATCTCGAGATGGTGTGTCGAGAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002666
PLIN1 MISSION shRNA Bacterial Glycerol Stock
perilipin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002666.3-226s1c1
Sequence:CCGGCGAATGCTTCCAGAAGACCTACTCGAGTAGGTCTTCTGGAAGCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160521    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002666.3-2055s1c1
Sequence:CCGGCGGATAAATATTTGCCACGAACTCGAGTTCGTGGCAAATATTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002666.3-1726s1c1
Sequence:CCGGCGGGTTTCTCTAACAAATAAACTCGAGTTTATTTGTTAGAGAAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158639    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002666.3-2349s1c1
Sequence:CCGGCCACATTTCCATTTGCATCATCTCGAGATGATGCAAATGGAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002666.3-457s1c1
Sequence:CCGGGATTGCTTCTGAGCTGAAGGACTCGAGTCCTTCAGCTCAGAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002666.3-282s1c1
Sequence:CCGGCTGTGTGCAATGCCTATGAGACTCGAGTCTCATAGGCATTGCACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002666.4-650s21c1
Sequence:CCGGGCCAGAGACACTGCGGAATTTCTCGAGAAATTCCGCAGTGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002666.4-857s21c1
Sequence:CCGGACCAACACCCTCTCTCGATACCTCGAGGTATCGAGAGAGGGTGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002666
PLIN1 MISSION shRNA shRNA Plasmid DNA
perilipin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002666.3-226s1c1
Sequence:CCGGCGAATGCTTCCAGAAGACCTACTCGAGTAGGTCTTCTGGAAGCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160521    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002666.3-2055s1c1
Sequence:CCGGCGGATAAATATTTGCCACGAACTCGAGTTCGTGGCAAATATTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002666.3-1726s1c1
Sequence:CCGGCGGGTTTCTCTAACAAATAAACTCGAGTTTATTTGTTAGAGAAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158639    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002666.3-2349s1c1
Sequence:CCGGCCACATTTCCATTTGCATCATCTCGAGATGATGCAAATGGAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002666.3-457s1c1
Sequence:CCGGGATTGCTTCTGAGCTGAAGGACTCGAGTCCTTCAGCTCAGAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002666.3-282s1c1
Sequence:CCGGCTGTGTGCAATGCCTATGAGACTCGAGTCTCATAGGCATTGCACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002666.4-650s21c1
Sequence:CCGGGCCAGAGACACTGCGGAATTTCTCGAGAAATTCCGCAGTGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002666.4-857s21c1
Sequence:CCGGACCAACACCCTCTCTCGATACCTCGAGGTATCGAGAGAGGGTGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002666
PLIN1 MISSION shRNA Lentiviral Transduction Particles
perilipin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002666.3-226s1c1
Sequence:CCGGCGAATGCTTCCAGAAGACCTACTCGAGTAGGTCTTCTGGAAGCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160521    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002666.3-2055s1c1
Sequence:CCGGCGGATAAATATTTGCCACGAACTCGAGTTCGTGGCAAATATTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002666.3-1726s1c1
Sequence:CCGGCGGGTTTCTCTAACAAATAAACTCGAGTTTATTTGTTAGAGAAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158639    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002666.3-2349s1c1
Sequence:CCGGCCACATTTCCATTTGCATCATCTCGAGATGATGCAAATGGAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002666.3-457s1c1
Sequence:CCGGGATTGCTTCTGAGCTGAAGGACTCGAGTCCTTCAGCTCAGAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002666.3-282s1c1
Sequence:CCGGCTGTGTGCAATGCCTATGAGACTCGAGTCTCATAGGCATTGCACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002666.4-650s21c1
Sequence:CCGGGCCAGAGACACTGCGGAATTTCTCGAGAAATTCCGCAGTGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002666.4-857s21c1
Sequence:CCGGACCAACACCCTCTCTCGATACCTCGAGGTATCGAGAGAGGGTGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks