EMAIL THIS PAGE TO A FRIEND

PLK5

polo-like kinase 5

Synonyms: PLK-5 PLK5P SgK384ps
UniProtKB ID: Q496M5, B3KNR4, Q1ZYM0
Gene ID:
Mouse(216166) polo-like kinase 5
Rat(314627) polo-like kinase 5
domestic cat(101098441) polo-like kinase 5
dog(485081) polo-like kinase 5
domestic guinea pig(100712681) polo-like kinase 5
naked mole-rat(101697228) polo-like kinase 5
cow(511891) polo-like kinase 5
sheep(101115963) polo-like kinase 5
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183152 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183152 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183152 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_927549 Rosetta Predictions human pricing
XM_932164 Rosetta Predictions human pricing
XR_015464 Rosetta Predictions human pricing
XR_015543 Rosetta Predictions human pricing
XR_041162 Rosetta Predictions human pricing
XM_001076512 Rosetta Predictions rat pricing
XM_234920 Rosetta Predictions rat pricing
NM_183152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290664 predicted 1081
2 SASI_Hs01_00290665 predicted 1078
3 SASI_Hs01_00290666 predicted 1298
4 SASI_Hs01_00290667 predicted 1293
5 SASI_Hs01_00290668 predicted 1071
6 SASI_Hs01_00290669 predicted 1060
7 SASI_Hs01_00290670 predicted 1081
8 SASI_Hs01_00290671 predicted 864
9 SASI_Hs01_00290672 predicted 1298
10 SASI_Hs01_00290673 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250786 predicted 1287
2 SASI_Hs01_00250787 predicted 1286
3 SASI_Hs01_00250788 predicted 1499
4 SASI_Hs01_00250789 predicted 1507
5 SASI_Hs01_00250790 predicted 1288
6 SASI_Hs01_00250791 predicted 1264
7 SASI_Hs01_00250792 predicted 1282
8 SASI_Hs01_00250793 predicted 1065
9 SASI_Hs01_00250794 predicted 1503
10 SASI_Hs01_00250795 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00488199 predicted 1322
2 SASI_Hs02_00488200 predicted 665
3 SASI_Hs02_00488201 predicted 1511
4 SASI_Hs02_00488202 predicted 286
5 SASI_Hs02_00488203 predicted 637
6 SASI_Hs02_00488204 predicted 1084
7 SASI_Hs02_00488205 predicted 1105
8 SASI_Hs02_00488206 predicted 893
9 SASI_Hs02_00488207 predicted 806
10 SASI_Hs02_00488208 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00488456 predicted 1327
2 SASI_Hs02_00488457 predicted 665
3 SASI_Hs02_00488458 predicted 1518
4 SASI_Hs02_00488459 predicted 287
5 SASI_Hs02_00488460 predicted 1086
6 SASI_Hs02_00488461 predicted 1104
7 SASI_Hs02_00488462 predicted 896
8 SASI_Hs02_00488463 predicted 812
9 SASI_Hs02_00488464 predicted 1344
10 SASI_Hs02_00488465 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525198 predicted 1325
2 SASI_Hs02_00525199 predicted 667
3 SASI_Hs02_00525200 predicted 1512
4 SASI_Hs02_00525201 predicted 279
5 SASI_Hs02_00525202 predicted 1086
6 SASI_Hs02_00525203 predicted 1110
7 SASI_Hs02_00525204 predicted 896
8 SASI_Hs02_00525205 predicted 814
9 SASI_Hs02_00525206 predicted 1344
10 SASI_Hs02_00525207 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353537 predicted 1082
2 SASI_Rn02_00353538 predicted 623
3 SASI_Rn02_00353539 predicted 1768
4 SASI_Rn02_00353540 predicted 1328
5 SASI_Rn02_00353541 predicted 2076
6 SASI_Rn02_00353542 predicted 1115
7 SASI_Rn02_00353543 predicted 1458
8 SASI_Rn02_00353544 predicted 583
9 SASI_Rn02_00353545 predicted 1099
10 SASI_Rn02_00353546 predicted 1594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388758 predicted 885
2 SASI_Rn02_00388759 predicted 2128
3 SASI_Rn02_00388760 predicted 627
4 SASI_Rn02_00388761 predicted 518
5 SASI_Rn02_00388762 predicted 885
6 SASI_Rn02_00388763 predicted 2203
7 SASI_Rn02_00388764 predicted 582
8 SASI_Rn02_00388765 predicted 343
9 SASI_Rn02_00388766 predicted 380
10 SASI_Rn02_00388767 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184079 predicted 222
2 SASI_Mm01_00184080 predicted 1704
3 SASI_Mm01_00184081 predicted 695
4 SASI_Mm01_00184082 predicted 1556
5 SASI_Mm01_00184083 predicted 1076
6 SASI_Mm01_00184084 predicted 1668
7 SASI_Mm01_00184085 predicted 1365
8 SASI_Mm01_00184088 predicted 1499
9 SASI_Mm02_00350207 predicted 777
10 SASI_Mm02_00350208 predicted 219
11 SASI_Mm01_00184086 predicted 1732
12 SASI_Mm01_00184087 predicted 1361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183152
PLK5 MISSION shRNA Bacterial Glycerol Stock
polo-like kinase 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-930s1c1
Sequence:CCGGCCACTTACTGCAAGATGACTTCTCGAGAAGTCATCTTGCAGTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-1675s1c1
Sequence:CCGGCAGGCTATGGACATGCTGTTTCTCGAGAAACAGCATGTCCATAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-1561s1c1
Sequence:CCGGCTGCGGCTCTTTGCCTGCTATCTCGAGATAGCAGGCAAAGAGCCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-1380s1c1
Sequence:CCGGCCTCAAGTATGGCTTCGGCTACTCGAGTAGCCGAAGCCATACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-802s1c1
Sequence:CCGGCCCTTGTCAGAGATGTACCAACTCGAGTTGGTACATCTCTGACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183152.2-251s21c1
Sequence:CCGGCAGCGCTGTGTTCGCTCTTAACTCGAGTTAAGAGCGAACACAGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183152.2-485s21c1
Sequence:CCGGAGAGCCTGAAGTGCGCTATTACTCGAGTAATAGCGCACTTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183152.2-563s21c1
Sequence:CCGGGGACCTGAAACCCAGTAATTTCTCGAGAAATTACTGGGTTTCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183152.2-1563s21c1
Sequence:CCGGCGGCTCTTTGCCTGCTATATGCTCGAGCATATAGCAGGCAAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183152
PLK5 MISSION shRNA shRNA Plasmid DNA
polo-like kinase 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-930s1c1
Sequence:CCGGCCACTTACTGCAAGATGACTTCTCGAGAAGTCATCTTGCAGTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-1675s1c1
Sequence:CCGGCAGGCTATGGACATGCTGTTTCTCGAGAAACAGCATGTCCATAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-1561s1c1
Sequence:CCGGCTGCGGCTCTTTGCCTGCTATCTCGAGATAGCAGGCAAAGAGCCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-1380s1c1
Sequence:CCGGCCTCAAGTATGGCTTCGGCTACTCGAGTAGCCGAAGCCATACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-802s1c1
Sequence:CCGGCCCTTGTCAGAGATGTACCAACTCGAGTTGGTACATCTCTGACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183152.2-251s21c1
Sequence:CCGGCAGCGCTGTGTTCGCTCTTAACTCGAGTTAAGAGCGAACACAGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183152.2-485s21c1
Sequence:CCGGAGAGCCTGAAGTGCGCTATTACTCGAGTAATAGCGCACTTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183152.2-563s21c1
Sequence:CCGGGGACCTGAAACCCAGTAATTTCTCGAGAAATTACTGGGTTTCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183152.2-1563s21c1
Sequence:CCGGCGGCTCTTTGCCTGCTATATGCTCGAGCATATAGCAGGCAAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183152
PLK5 MISSION shRNA Lentiviral Transduction Particles
polo-like kinase 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-930s1c1
Sequence:CCGGCCACTTACTGCAAGATGACTTCTCGAGAAGTCATCTTGCAGTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-1675s1c1
Sequence:CCGGCAGGCTATGGACATGCTGTTTCTCGAGAAACAGCATGTCCATAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-1561s1c1
Sequence:CCGGCTGCGGCTCTTTGCCTGCTATCTCGAGATAGCAGGCAAAGAGCCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-1380s1c1
Sequence:CCGGCCTCAAGTATGGCTTCGGCTACTCGAGTAGCCGAAGCCATACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183152.1-802s1c1
Sequence:CCGGCCCTTGTCAGAGATGTACCAACTCGAGTTGGTACATCTCTGACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183152.2-251s21c1
Sequence:CCGGCAGCGCTGTGTTCGCTCTTAACTCGAGTTAAGAGCGAACACAGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183152.2-485s21c1
Sequence:CCGGAGAGCCTGAAGTGCGCTATTACTCGAGTAATAGCGCACTTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183152.2-563s21c1
Sequence:CCGGGGACCTGAAACCCAGTAATTTCTCGAGAAATTACTGGGTTTCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183152.2-1563s21c1
Sequence:CCGGCGGCTCTTTGCCTGCTATATGCTCGAGCATATAGCAGGCAAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks