EMAIL THIS PAGE TO A FRIEND

PLN

phospholamban

Synonyms: CMD1P CMH18 PLB
UniProtKB ID: P26678
Gene ID:
Human(5350) Summary: The protein encoded by this gene is found as a pentamer and is a major substrate for the cAMP-dependent protein kinase in cardiac muscle. The encoded protein is an inhibitor of cardiac muscle sarcoplasmic reticulum Ca(2+)-ATPase in the unphosphorylated state, but inhibition is relieved upon phosphorylation of the protein. The subsequent activation of the Ca(2+) pump leads to enhanced muscle relaxation rates, thereby contributing to the inotropic response elicited in heart by beta-agonists. The encoded protein is a key regulator of cardiac diastolic function. Mutations in this gene are a cause of inherited human dilated cardiomyopathy with refractory congestive heart failure. [provided by RefSeq, Jul 2008]
Mouse(18821) phospholamban
Rat(64672) phospholamban
chicken(396378) phospholamban
domestic cat(101097897) phospholamban
dog(414755) phospholamban
cow(100125240) phospholamban
sheep(101102067) phospholamban
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002667 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023129 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023129 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023129 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126511 MISSION® esiRNA esiRNA human PLN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002667 Rosetta Predictions human pricing
NM_022707 Rosetta Predictions rat pricing
XM_579462 Rosetta Predictions rat pricing
NM_023129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238387 predicted 669
2 SASI_Hs01_00238388 predicted 662
3 SASI_Hs01_00238389 predicted 791
4 SASI_Hs01_00238391 predicted 598
5 SASI_Hs02_00334232 predicted 283
6 SASI_Hs01_00238392 predicted 593
7 SASI_Hs01_00238394 predicted 773
8 SASI_Hs02_00334233 predicted 588
9 SASI_Hs02_00334234 predicted 313
10 SASI_Hs02_00334235 predicted 659
11 SASI_Hs01_00238385 predicted 300
12 SASI_Hs01_00238386 predicted 270
13 SASI_Hs01_00238390 predicted 260
14 SASI_Hs01_00238393 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035433 predicted 432
2 SASI_Rn01_00035434 predicted 467
3 SASI_Rn01_00035435 predicted 197
4 SASI_Rn02_00263529 predicted 435
5 SASI_Rn01_00035437 predicted 476
6 SASI_Rn01_00035440 predicted 441
7 SASI_Rn02_00263530 predicted 470
8 SASI_Rn02_00263531 predicted 446
9 SASI_Rn02_00263532 predicted 261
10 SASI_Rn02_00263533 predicted 369
11 SASI_Rn01_00035431 predicted 277
12 SASI_Rn01_00035432 predicted 251
13 SASI_Rn01_00035436 predicted 253
14 SASI_Rn01_00035438 predicted 306
15 SASI_Rn01_00035439 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162650 predicted 267
2 SASI_Rn01_00162651 predicted 259
3 SASI_Rn01_00162652 predicted 429
4 SASI_Rn01_00162653 predicted 255
5 SASI_Rn01_00162654 predicted 312
6 SASI_Rn01_00162655 predicted 361
7 SASI_Rn01_00162656 predicted 201
8 SASI_Rn01_00162657 predicted 264
9 SASI_Rn01_00162658 predicted 422
10 SASI_Rn01_00162659 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032505 predicted 376
2 SASI_Mm01_00032506 predicted 482
3 SASI_Mm01_00032508 predicted 471
4 SASI_Mm01_00032509 predicted 372
5 SASI_Mm02_00326826 predicted 568
6 SASI_Mm01_00032510 predicted 540
7 SASI_Mm01_00032511 predicted 449
8 SASI_Mm01_00032512 predicted 556
9 SASI_Mm02_00326827 predicted 237
10 SASI_Mm02_00326828 predicted 608
11 SASI_Mm01_00032503 predicted 584
12 SASI_Mm01_00032504 predicted 572
13 SASI_Mm01_00032507 predicted 303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002667
PLN MISSION shRNA Bacterial Glycerol Stock
phospholamban
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002667.2-313s1c1
Sequence:CCGGGATCTGTATCATCGTGATGCTCTCGAGAGCATCACGATGATACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002667.2-665s1c1
Sequence:CCGGGCCAACAAGTTCACTTCATATCTCGAGATATGAAGTGAACTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002667.2-438s1c1
Sequence:CCGGCCTGAGTAGAAGAGTTTCTTTCTCGAGAAAGAAACTCTTCTACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002667.2-213s1c1
Sequence:CCGGCTATAAGAAGAGCCTCAACCACTCGAGTGGTTGAGGCTCTTCTTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147928    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002667.2-603s1c1
Sequence:CCGGGCTCACAAATTTCTATCCCAACTCGAGTTGGGATAGAAATTTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002667.2-310s1c1
Sequence:CCGGGCTGATCTGTATCATCGTGATCTCGAGATCACGATGATACAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002667.2-210s1c1
Sequence:CCGGCAGCTATAAGAAGAGCCTCAACTCGAGTTGAGGCTCTTCTTATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002667.2-219s1c1
Sequence:CCGGGAAGAGCCTCAACCATTGAAACTCGAGTTTCAATGGTTGAGGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002667.2-1274s1c1
Sequence:CCGGCCTAACATCCAATGCAGGCAACTCGAGTTGCCTGCATTGGATGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002667
PLN MISSION shRNA shRNA Plasmid DNA
phospholamban
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002667.2-313s1c1
Sequence:CCGGGATCTGTATCATCGTGATGCTCTCGAGAGCATCACGATGATACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002667.2-665s1c1
Sequence:CCGGGCCAACAAGTTCACTTCATATCTCGAGATATGAAGTGAACTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002667.2-438s1c1
Sequence:CCGGCCTGAGTAGAAGAGTTTCTTTCTCGAGAAAGAAACTCTTCTACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002667.2-213s1c1
Sequence:CCGGCTATAAGAAGAGCCTCAACCACTCGAGTGGTTGAGGCTCTTCTTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147928    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002667.2-603s1c1
Sequence:CCGGGCTCACAAATTTCTATCCCAACTCGAGTTGGGATAGAAATTTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002667.2-310s1c1
Sequence:CCGGGCTGATCTGTATCATCGTGATCTCGAGATCACGATGATACAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002667.2-210s1c1
Sequence:CCGGCAGCTATAAGAAGAGCCTCAACTCGAGTTGAGGCTCTTCTTATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002667.2-219s1c1
Sequence:CCGGGAAGAGCCTCAACCATTGAAACTCGAGTTTCAATGGTTGAGGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002667.2-1274s1c1
Sequence:CCGGCCTAACATCCAATGCAGGCAACTCGAGTTGCCTGCATTGGATGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002667
PLN MISSION shRNA Lentiviral Transduction Particles
phospholamban
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002667.2-313s1c1
Sequence:CCGGGATCTGTATCATCGTGATGCTCTCGAGAGCATCACGATGATACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002667.2-665s1c1
Sequence:CCGGGCCAACAAGTTCACTTCATATCTCGAGATATGAAGTGAACTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002667.2-438s1c1
Sequence:CCGGCCTGAGTAGAAGAGTTTCTTTCTCGAGAAAGAAACTCTTCTACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002667.2-213s1c1
Sequence:CCGGCTATAAGAAGAGCCTCAACCACTCGAGTGGTTGAGGCTCTTCTTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147928    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002667.2-603s1c1
Sequence:CCGGGCTCACAAATTTCTATCCCAACTCGAGTTGGGATAGAAATTTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002667.2-310s1c1
Sequence:CCGGGCTGATCTGTATCATCGTGATCTCGAGATCACGATGATACAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002667.2-210s1c1
Sequence:CCGGCAGCTATAAGAAGAGCCTCAACTCGAGTTGAGGCTCTTCTTATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002667.2-219s1c1
Sequence:CCGGGAAGAGCCTCAACCATTGAAACTCGAGTTTCAATGGTTGAGGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002667.2-1274s1c1
Sequence:CCGGCCTAACATCCAATGCAGGCAACTCGAGTTGCCTGCATTGGATGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023129
PLN MISSION shRNA Bacterial Glycerol Stock
phospholamban
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023129.3-1137s1c1
Sequence:CCGGGCTGTGATAATCACTAAAGATCTCGAGATCTTTAGTGATTATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023129.3-246s1c1
Sequence:CCGGACTATTGAAATGCCTCAGCAACTCGAGTTGCTGAGGCATTTCAATAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023129.3-266s1c1
Sequence:CCGGAGCACGTCAGAATCTCCAGAACTCGAGTTCTGGAGATTCTGACGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023129.3-326s1c1
Sequence:CCGGGCTGATCTGCATCATTGTGATCTCGAGATCACAATGATGCAGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023129.3-240s1c1
Sequence:CCGGGCCTCCACTATTGAAATGCCTCTCGAGAGGCATTTCAATAGTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023129.5-313s21c1
Sequence:CCGGTATCAATTTCTGCCTCATCTTCTCGAGAAGATGAGGCAGAAATTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023129.5-403s21c1
Sequence:CCGGACATGCCAACTCAGCTTAAAGCTCGAGCTTTAAGCTGAGTTGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023129.5-479s21c1
Sequence:CCGGCTTTGTGAGGGTCACGATTAACTCGAGTTAATCGTGACCCTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023129.5-234s21c1
Sequence:CCGGACCTCACTCGCTCGGCTATCACTCGAGTGATAGCCGAGCGAGTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023129
PLN MISSION shRNA shRNA Plasmid DNA
phospholamban
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023129.3-1137s1c1
Sequence:CCGGGCTGTGATAATCACTAAAGATCTCGAGATCTTTAGTGATTATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023129.3-246s1c1
Sequence:CCGGACTATTGAAATGCCTCAGCAACTCGAGTTGCTGAGGCATTTCAATAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023129.3-266s1c1
Sequence:CCGGAGCACGTCAGAATCTCCAGAACTCGAGTTCTGGAGATTCTGACGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023129.3-326s1c1
Sequence:CCGGGCTGATCTGCATCATTGTGATCTCGAGATCACAATGATGCAGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023129.3-240s1c1
Sequence:CCGGGCCTCCACTATTGAAATGCCTCTCGAGAGGCATTTCAATAGTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023129.5-313s21c1
Sequence:CCGGTATCAATTTCTGCCTCATCTTCTCGAGAAGATGAGGCAGAAATTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023129.5-403s21c1
Sequence:CCGGACATGCCAACTCAGCTTAAAGCTCGAGCTTTAAGCTGAGTTGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023129.5-479s21c1
Sequence:CCGGCTTTGTGAGGGTCACGATTAACTCGAGTTAATCGTGACCCTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023129.5-234s21c1
Sequence:CCGGACCTCACTCGCTCGGCTATCACTCGAGTGATAGCCGAGCGAGTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023129
PLN MISSION shRNA Lentiviral Transduction Particles
phospholamban
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023129.3-1137s1c1
Sequence:CCGGGCTGTGATAATCACTAAAGATCTCGAGATCTTTAGTGATTATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023129.3-246s1c1
Sequence:CCGGACTATTGAAATGCCTCAGCAACTCGAGTTGCTGAGGCATTTCAATAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023129.3-266s1c1
Sequence:CCGGAGCACGTCAGAATCTCCAGAACTCGAGTTCTGGAGATTCTGACGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023129.3-326s1c1
Sequence:CCGGGCTGATCTGCATCATTGTGATCTCGAGATCACAATGATGCAGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023129.3-240s1c1
Sequence:CCGGGCCTCCACTATTGAAATGCCTCTCGAGAGGCATTTCAATAGTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023129.5-313s21c1
Sequence:CCGGTATCAATTTCTGCCTCATCTTCTCGAGAAGATGAGGCAGAAATTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023129.5-403s21c1
Sequence:CCGGACATGCCAACTCAGCTTAAAGCTCGAGCTTTAAGCTGAGTTGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023129.5-479s21c1
Sequence:CCGGCTTTGTGAGGGTCACGATTAACTCGAGTTAATCGTGACCCTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023129.5-234s21c1
Sequence:CCGGACCTCACTCGCTCGGCTATCACTCGAGTGATAGCCGAGCGAGTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks