EMAIL THIS PAGE TO A FRIEND

PLSCR1

phospholipid scramblase 1

Synonyms: MMTRA1B
UniProtKB ID: O15162, B2R8H8
Gene ID:
Mouse(22038) phospholipid scramblase 1
Rat(117540) phospholipid scramblase 1
chicken(424883) phospholipid scramblase 1
dog(611500) phospholipid scramblase 1
domestic cat(101085233) phospholipid scramblase 1
cow(513193) phospholipid scramblase 1
cow(100125943) phospholipid scramblase 1
naked mole-rat(101709876) phospholipid scramblase 1
domestic guinea pig(100712949) phospholipid scramblase 1
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021105 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021105 Rosetta Predictions human pricing
NM_057194 Rosetta Predictions rat pricing
NM_011636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239452 predicted 1418
2 SASI_Hs01_00239453 predicted 809
3 SASI_Hs01_00239455 predicted 919
4 SASI_Hs01_00239456 predicted 1194
5 SASI_Hs01_00239457 predicted 1249
6 SASI_Hs01_00239458 predicted 1187
7 SASI_Hs01_00239459 predicted 1092
8 SASI_Hs01_00239460 predicted 829
9 SASI_Hs02_00354596 predicted 686
10 SASI_Hs02_00354597 predicted 691
11 SASI_Hs01_00239454 predicted 895
12 SASI_Hs01_00239461 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034165 predicted 1161
2 SASI_Rn01_00034166 predicted 1200
3 SASI_Rn01_00034167 predicted 529
4 SASI_Rn01_00034168 predicted 1256
5 SASI_Rn01_00034169 predicted 611
6 SASI_Rn01_00034170 predicted 930
7 SASI_Rn01_00034171 predicted 1260
8 SASI_Rn01_00034172 predicted 844
9 SASI_Rn01_00034173 predicted 702
10 SASI_Rn01_00034174 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079434 predicted 1173
2 SASI_Mm02_00321087 predicted 619
3 SASI_Mm01_00079435 predicted 1183
4 SASI_Mm01_00079436 predicted 928
5 SASI_Mm01_00079437 predicted 944
6 SASI_Mm02_00321088 predicted 499
7 SASI_Mm01_00079438 predicted 938
8 SASI_Mm01_00079439 predicted 1183
9 SASI_Mm01_00079440 predicted 1153
10 SASI_Mm01_00079441 predicted 701
11 SASI_Mm01_00079442 predicted 911
12 SASI_Mm01_00079443 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011636
VALIDATED
PLSCR1 MISSION shRNA Bacterial Glycerol Stock
phospholipid scramblase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011636.2-502s21c1
Sequence:CCGGGCTGGAATACTTAGCTCAGATCTCGAGATCTGAGCTAAGTATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011636.2-1087s21c1
Sequence:CCGGGCTTGGTGCTTGTTTCCTCATCTCGAGATGAGGAAACAAGCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011636.2-1017s21c1
Sequence:CCGGCCTTCACGGATGCAGACAATTCTCGAGAATTGTCTGCATCCGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011636.2-528s21c1
Sequence:CCGGAGCTTCTGGTTCATCAGCAAACTCGAGTTTGCTGATGAACCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-1075s1c1
Sequence:CCGGGCTCCCAAATTAGAGTTTATTCTCGAGAATAAACTCTAATTTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-278s1c1
Sequence:CCGGAGCTTCTGGTTCATCAGCAAACTCGAGTTTGCTGATGAACCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-252s1c1
Sequence:CCGGGCTGGAATACTTAGCTCAGATCTCGAGATCTGAGCTAAGTATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-837s1c1
Sequence:CCGGGCTTGGTGCTTGTTTCCTCATCTCGAGATGAGGAAACAAGCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-767s1c1
Sequence:CCGGCCTTCACGGATGCAGACAATTCTCGAGAATTGTCTGCATCCGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011636
VALIDATED
PLSCR1 MISSION shRNA shRNA Plasmid DNA
phospholipid scramblase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011636.2-502s21c1
Sequence:CCGGGCTGGAATACTTAGCTCAGATCTCGAGATCTGAGCTAAGTATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011636.2-1087s21c1
Sequence:CCGGGCTTGGTGCTTGTTTCCTCATCTCGAGATGAGGAAACAAGCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011636.2-1017s21c1
Sequence:CCGGCCTTCACGGATGCAGACAATTCTCGAGAATTGTCTGCATCCGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011636.2-528s21c1
Sequence:CCGGAGCTTCTGGTTCATCAGCAAACTCGAGTTTGCTGATGAACCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-1075s1c1
Sequence:CCGGGCTCCCAAATTAGAGTTTATTCTCGAGAATAAACTCTAATTTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-278s1c1
Sequence:CCGGAGCTTCTGGTTCATCAGCAAACTCGAGTTTGCTGATGAACCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-252s1c1
Sequence:CCGGGCTGGAATACTTAGCTCAGATCTCGAGATCTGAGCTAAGTATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-837s1c1
Sequence:CCGGGCTTGGTGCTTGTTTCCTCATCTCGAGATGAGGAAACAAGCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-767s1c1
Sequence:CCGGCCTTCACGGATGCAGACAATTCTCGAGAATTGTCTGCATCCGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011636
VALIDATED
PLSCR1 MISSION shRNA Lentiviral Transduction Particles
phospholipid scramblase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011636.2-502s21c1
Sequence:CCGGGCTGGAATACTTAGCTCAGATCTCGAGATCTGAGCTAAGTATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011636.2-1087s21c1
Sequence:CCGGGCTTGGTGCTTGTTTCCTCATCTCGAGATGAGGAAACAAGCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011636.2-1017s21c1
Sequence:CCGGCCTTCACGGATGCAGACAATTCTCGAGAATTGTCTGCATCCGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011636.2-528s21c1
Sequence:CCGGAGCTTCTGGTTCATCAGCAAACTCGAGTTTGCTGATGAACCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-1075s1c1
Sequence:CCGGGCTCCCAAATTAGAGTTTATTCTCGAGAATAAACTCTAATTTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-278s1c1
Sequence:CCGGAGCTTCTGGTTCATCAGCAAACTCGAGTTTGCTGATGAACCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-252s1c1
Sequence:CCGGGCTGGAATACTTAGCTCAGATCTCGAGATCTGAGCTAAGTATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-837s1c1
Sequence:CCGGGCTTGGTGCTTGTTTCCTCATCTCGAGATGAGGAAACAAGCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011636.1-767s1c1
Sequence:CCGGCCTTCACGGATGCAGACAATTCTCGAGAATTGTCTGCATCCGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021105
VALIDATED
PLSCR1 MISSION shRNA Bacterial Glycerol Stock
phospholipid scramblase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021105.2-1604s21c1
Sequence:CCGGATTATGATCTCTGATTCATTGCTCGAGCAATGAATCAGAGATCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021105.2-1226s21c1
Sequence:CCGGCAGTTCCCTTTAGACCTTGATCTCGAGATCAAGGTCTAAAGGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021105.2-1195s21c1
Sequence:CCGGGGCATTTACAGACGCTGATAACTCGAGTTATCAGCGTCTGTAAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021105.2-1332s21c1
Sequence:CCGGCAGGAGTGTGGTAGTGGATTACTCGAGTAATCCACTACCACACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021105.2-989s21c1
Sequence:CCGGGTACCAATAGGTTATGTTATTCTCGAGAATAACATAACCTATTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021105.1-293s1c1
Sequence:CCGGCCGGAAACAAACTTGCCAGTTCTCGAGAACTGGCAAGTTTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021105.1-542s1c1
Sequence:CCGGCCACCTGGATTAGAATATTTACTCGAGTAAATATTCTAATCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021105.1-1094s1c1
Sequence:CCGGCAGTTCCCTTTAGACCTTGATCTCGAGATCAAGGTCTAAAGGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021105.1-455s1c1
Sequence:CCGGCCAGTGTATAATCAGCCAGTACTCGAGTACTGGCTGATTATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021105.1-684s1c1
Sequence:CCGGCGGAAGATACTGATTGCTGTACTCGAGTACAGCAATCAGTATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021105
VALIDATED
PLSCR1 MISSION shRNA shRNA Plasmid DNA
phospholipid scramblase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021105.2-1604s21c1
Sequence:CCGGATTATGATCTCTGATTCATTGCTCGAGCAATGAATCAGAGATCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021105.2-1226s21c1
Sequence:CCGGCAGTTCCCTTTAGACCTTGATCTCGAGATCAAGGTCTAAAGGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021105.2-1195s21c1
Sequence:CCGGGGCATTTACAGACGCTGATAACTCGAGTTATCAGCGTCTGTAAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021105.2-1332s21c1
Sequence:CCGGCAGGAGTGTGGTAGTGGATTACTCGAGTAATCCACTACCACACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021105.2-989s21c1
Sequence:CCGGGTACCAATAGGTTATGTTATTCTCGAGAATAACATAACCTATTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021105.1-293s1c1
Sequence:CCGGCCGGAAACAAACTTGCCAGTTCTCGAGAACTGGCAAGTTTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021105.1-542s1c1
Sequence:CCGGCCACCTGGATTAGAATATTTACTCGAGTAAATATTCTAATCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021105.1-1094s1c1
Sequence:CCGGCAGTTCCCTTTAGACCTTGATCTCGAGATCAAGGTCTAAAGGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021105.1-455s1c1
Sequence:CCGGCCAGTGTATAATCAGCCAGTACTCGAGTACTGGCTGATTATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021105.1-684s1c1
Sequence:CCGGCGGAAGATACTGATTGCTGTACTCGAGTACAGCAATCAGTATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021105
VALIDATED
PLSCR1 MISSION shRNA Lentiviral Transduction Particles
phospholipid scramblase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021105.2-1604s21c1
Sequence:CCGGATTATGATCTCTGATTCATTGCTCGAGCAATGAATCAGAGATCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021105.2-1226s21c1
Sequence:CCGGCAGTTCCCTTTAGACCTTGATCTCGAGATCAAGGTCTAAAGGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021105.2-1195s21c1
Sequence:CCGGGGCATTTACAGACGCTGATAACTCGAGTTATCAGCGTCTGTAAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021105.2-1332s21c1
Sequence:CCGGCAGGAGTGTGGTAGTGGATTACTCGAGTAATCCACTACCACACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021105.2-989s21c1
Sequence:CCGGGTACCAATAGGTTATGTTATTCTCGAGAATAACATAACCTATTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021105.1-293s1c1
Sequence:CCGGCCGGAAACAAACTTGCCAGTTCTCGAGAACTGGCAAGTTTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021105.1-542s1c1
Sequence:CCGGCCACCTGGATTAGAATATTTACTCGAGTAAATATTCTAATCCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021105.1-1094s1c1
Sequence:CCGGCAGTTCCCTTTAGACCTTGATCTCGAGATCAAGGTCTAAAGGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021105.1-455s1c1
Sequence:CCGGCCAGTGTATAATCAGCCAGTACTCGAGTACTGGCTGATTATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021105.1-684s1c1
Sequence:CCGGCGGAAGATACTGATTGCTGTACTCGAGTACAGCAATCAGTATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks