EMAIL THIS PAGE TO A FRIEND

PLSCR4

phospholipid scramblase 4

Synonyms: TRA1
UniProtKB ID: Q9NRQ2, A8K2E9, Q2TTR3, Q658L3, Q6ZR73, Q7Z505
Gene ID:
Mouse(235527) phospholipid scramblase 4
Rat(300900) phospholipid scramblase 4
dog(611495) phospholipid scramblase 4
naked mole-rat(101709290) phospholipid scramblase 4
domestic guinea pig(100735494) phospholipid scramblase 4
cow(539290) phospholipid scramblase 4
sheep(101103365) phospholipid scramblase 4
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020353 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064551 MISSION® esiRNA esiRNA human PLSCR4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128304 Rosetta Predictions human pricing
NM_001128305 Rosetta Predictions human pricing
NM_001128306 Rosetta Predictions human pricing
NM_020353 Rosetta Predictions human pricing
NM_001012000 Rosetta Predictions rat pricing
XM_576448 Rosetta Predictions rat pricing
NM_178711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331036 predicted 1297
2 SASI_Hs02_00331037 predicted 617
3 SASI_Hs02_00331038 predicted 595
4 SASI_Hs02_00331039 predicted 1397
5 SASI_Hs02_00331040 predicted 856
6 SASI_Hs02_00331041 predicted 1416
7 SASI_Hs02_00331042 predicted 728
8 SASI_Hs02_00331043 predicted 978
9 SASI_Hs02_00331044 predicted 1147
10 SASI_Hs02_00331045 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331046 predicted 1256
2 SASI_Hs02_00331047 predicted 581
3 SASI_Hs02_00331048 predicted 553
4 SASI_Hs02_00331049 predicted 1362
5 SASI_Hs02_00331050 predicted 813
6 SASI_Hs02_00331051 predicted 1378
7 SASI_Hs02_00331052 predicted 682
8 SASI_Hs02_00331053 predicted 942
9 SASI_Hs02_00331054 predicted 1109
10 SASI_Hs02_00331055 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331056 predicted 900
2 SASI_Hs02_00331057 predicted 1200
3 SASI_Hs02_00331058 predicted 967
4 SASI_Hs02_00331059 predicted 470
5 SASI_Hs02_00331060 predicted 1181
6 SASI_Hs02_00331061 predicted 1147
7 SASI_Hs02_00331062 predicted 1002
8 SASI_Hs02_00331063 predicted 1020
9 SASI_Hs02_00331064 predicted 852
10 SASI_Hs02_00331065 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183746 predicted 1072
2 SASI_Hs01_00183747 predicted 399
3 SASI_Hs01_00183748 predicted 369
4 SASI_Hs01_00183749 predicted 597
5 SASI_Hs01_00183750 predicted 1178
6 SASI_Hs01_00183751 predicted 632
7 SASI_Hs01_00183752 predicted 1185
8 SASI_Hs01_00183754 predicted 502
9 SASI_Hs02_00353290 predicted 757
10 SASI_Hs02_00353291 predicted 929
11 SASI_Hs01_00183745 predicted 622
12 SASI_Hs01_00183753 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094250 predicted 1264
2 SASI_Rn01_00094251 predicted 1124
3 SASI_Rn01_00094252 predicted 1378
4 SASI_Rn01_00094253 predicted 676
5 SASI_Rn01_00094254 predicted 1363
6 SASI_Rn02_00200049 predicted 1379
7 SASI_Rn01_00094255 predicted 1140
8 SASI_Rn01_00094256 predicted 751
9 SASI_Rn01_00094257 predicted 1023
10 SASI_Rn01_00094259 predicted 591
11 SASI_Rn01_00094258 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147982 predicted 1264
2 SASI_Rn01_00147983 predicted 1123
3 SASI_Rn01_00147984 predicted 1377
4 SASI_Rn01_00147985 predicted 687
5 SASI_Rn01_00147986 predicted 1365
6 SASI_Rn01_00147987 predicted 1141
7 SASI_Rn01_00147988 predicted 756
8 SASI_Rn01_00147989 predicted 1029
9 SASI_Rn01_00147990 predicted 593
10 SASI_Rn01_00147991 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098093 predicted 811
2 SASI_Mm01_00098094 predicted 800
3 SASI_Mm01_00098095 predicted 1084
4 SASI_Mm01_00098096 predicted 1003
5 SASI_Mm01_00098097 predicted 648
6 SASI_Mm01_00098098 predicted 1342
7 SASI_Mm01_00098099 predicted 905
8 SASI_Mm01_00098100 predicted 1207
9 SASI_Mm01_00098101 predicted 1065
10 SASI_Mm01_00098102 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178711
PLSCR4 MISSION shRNA Bacterial Glycerol Stock
phospholipid scramblase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178711.3-1907s1c1
Sequence:CCGGGCACAGAAATAATGTGCTTTACTCGAGTAAAGCACATTATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178711.3-885s1c1
Sequence:CCGGCCTCCTGGTTTGGAATACTTACTCGAGTAAGTATTCCAAACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178711.3-888s1c1
Sequence:CCGGCCTGGTTTGGAATACTTAGCTCTCGAGAGCTAAGTATTCCAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178711.3-1248s1c1
Sequence:CCGGGCCTCTTATAGCATCCAGAATCTCGAGATTCTGGATGCTATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178711.3-1361s1c1
Sequence:CCGGCGTGTCTAACATCGGCAGTATCTCGAGATACTGCCGATGTTAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178711
PLSCR4 MISSION shRNA shRNA Plasmid DNA
phospholipid scramblase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178711.3-1907s1c1
Sequence:CCGGGCACAGAAATAATGTGCTTTACTCGAGTAAAGCACATTATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178711.3-885s1c1
Sequence:CCGGCCTCCTGGTTTGGAATACTTACTCGAGTAAGTATTCCAAACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178711.3-888s1c1
Sequence:CCGGCCTGGTTTGGAATACTTAGCTCTCGAGAGCTAAGTATTCCAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178711.3-1248s1c1
Sequence:CCGGGCCTCTTATAGCATCCAGAATCTCGAGATTCTGGATGCTATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178711.3-1361s1c1
Sequence:CCGGCGTGTCTAACATCGGCAGTATCTCGAGATACTGCCGATGTTAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178711
PLSCR4 MISSION shRNA Lentiviral Transduction Particles
phospholipid scramblase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178711.3-1907s1c1
Sequence:CCGGGCACAGAAATAATGTGCTTTACTCGAGTAAAGCACATTATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178711.3-885s1c1
Sequence:CCGGCCTCCTGGTTTGGAATACTTACTCGAGTAAGTATTCCAAACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178711.3-888s1c1
Sequence:CCGGCCTGGTTTGGAATACTTAGCTCTCGAGAGCTAAGTATTCCAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178711.3-1248s1c1
Sequence:CCGGGCCTCTTATAGCATCCAGAATCTCGAGATTCTGGATGCTATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178711.3-1361s1c1
Sequence:CCGGCGTGTCTAACATCGGCAGTATCTCGAGATACTGCCGATGTTAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020353
VALIDATED
PLSCR4 MISSION shRNA Bacterial Glycerol Stock
phospholipid scramblase 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020353.1-233s1c1
Sequence:CCGGCCTCCTGAATACAGTTCTCATCTCGAGATGAGAACTGTATTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020353.1-906s1c1
Sequence:CCGGGCTGTGGTTCAGATTCTGTTTCTCGAGAAACAGAATCTGAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020353.1-974s1c1
Sequence:CCGGCGGAAGTGGAATGGTTTGTTACTCGAGTAACAAACCATTCCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020353.1-410s1c1
Sequence:CCGGCCTATGCCAAATCAGTCTGTTCTCGAGAACAGACTGATTTGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_020353.1-473s1c1
Sequence:CCGGCCTCCTGGTCTGGAATACTTACTCGAGTAAGTATTCCAGACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020353.2-484s21c1
Sequence:CCGGCCGGTATCAGCCTGGCAAATACTCGAGTATTTGCCAGGCTGATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020353.2-1416s21c1
Sequence:CCGGGAGTATCTCTCTAGTAGAATACTCGAGTATTCTACTAGAGAGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020353.2-736s21c1
Sequence:CCGGGAATGCCTATCGGACACTAAGCTCGAGCTTAGTGTCCGATAGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020353.2-1046s21c1
Sequence:CCGGATATCCAACATCGGCAGTATTCTCGAGAATACTGCCGATGTTGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020353
VALIDATED
PLSCR4 MISSION shRNA shRNA Plasmid DNA
phospholipid scramblase 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020353.1-233s1c1
Sequence:CCGGCCTCCTGAATACAGTTCTCATCTCGAGATGAGAACTGTATTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020353.1-906s1c1
Sequence:CCGGGCTGTGGTTCAGATTCTGTTTCTCGAGAAACAGAATCTGAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020353.1-974s1c1
Sequence:CCGGCGGAAGTGGAATGGTTTGTTACTCGAGTAACAAACCATTCCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020353.1-410s1c1
Sequence:CCGGCCTATGCCAAATCAGTCTGTTCTCGAGAACAGACTGATTTGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_020353.1-473s1c1
Sequence:CCGGCCTCCTGGTCTGGAATACTTACTCGAGTAAGTATTCCAGACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020353.2-484s21c1
Sequence:CCGGCCGGTATCAGCCTGGCAAATACTCGAGTATTTGCCAGGCTGATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020353.2-1416s21c1
Sequence:CCGGGAGTATCTCTCTAGTAGAATACTCGAGTATTCTACTAGAGAGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020353.2-736s21c1
Sequence:CCGGGAATGCCTATCGGACACTAAGCTCGAGCTTAGTGTCCGATAGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020353.2-1046s21c1
Sequence:CCGGATATCCAACATCGGCAGTATTCTCGAGAATACTGCCGATGTTGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020353
VALIDATED
PLSCR4 MISSION shRNA Lentiviral Transduction Particles
phospholipid scramblase 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020353.1-233s1c1
Sequence:CCGGCCTCCTGAATACAGTTCTCATCTCGAGATGAGAACTGTATTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020353.1-906s1c1
Sequence:CCGGGCTGTGGTTCAGATTCTGTTTCTCGAGAAACAGAATCTGAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020353.1-974s1c1
Sequence:CCGGCGGAAGTGGAATGGTTTGTTACTCGAGTAACAAACCATTCCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020353.1-410s1c1
Sequence:CCGGCCTATGCCAAATCAGTCTGTTCTCGAGAACAGACTGATTTGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_020353.1-473s1c1
Sequence:CCGGCCTCCTGGTCTGGAATACTTACTCGAGTAAGTATTCCAGACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020353.2-484s21c1
Sequence:CCGGCCGGTATCAGCCTGGCAAATACTCGAGTATTTGCCAGGCTGATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020353.2-1416s21c1
Sequence:CCGGGAGTATCTCTCTAGTAGAATACTCGAGTATTCTACTAGAGAGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020353.2-736s21c1
Sequence:CCGGGAATGCCTATCGGACACTAAGCTCGAGCTTAGTGTCCGATAGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020353.2-1046s21c1
Sequence:CCGGATATCCAACATCGGCAGTATTCTCGAGAATACTGCCGATGTTGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks