EMAIL THIS PAGE TO A FRIEND

PMCHL2

pro-melanin-concentrating hormone-like 2, pseudogene

Species: Human PMCHL2(5370)
UniProtKB ID: Q9BQD1
Gene ID:
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031888 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003922 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380511 predicted 407
2 SASI_Hs02_00380512 predicted 415
3 SASI_Hs02_00380513 predicted 345
4 SASI_Hs02_00380514 predicted 351
5 SASI_Hs02_00380515 predicted 373
6 SASI_Hs02_00380516 predicted 369
7 SASI_Hs02_00380517 predicted 415
8 SASI_Hs02_00380518 predicted 375
9 SASI_Hs02_00380519 predicted 363
10 SASI_Hs02_00380520 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031888
PMCHL2 MISSION shRNA Bacterial Glycerol Stock
pro-melanin-concentrating hormone-like 2, pseudogene
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031888.1-104s1c1
Sequence:CCGGCACTAGAAGGATCTGTAGCTTCTCGAGAAGCTACAGATCCTTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031888.1-664s1c1
Sequence:CCGGGCCTGTGTTCTGTAAAGAGAACTCGAGTTCTCTTTACAGAACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031888.1-148s1c1
Sequence:CCGGGATACCGAATCAACACTAGAACTCGAGTTCTAGTGTTGATTCGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031888.1-100s1c1
Sequence:CCGGCTTGCACTAGAAGGATCTGTACTCGAGTACAGATCCTTCTAGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031888.1-142s1c1
Sequence:CCGGGTTCAGGATACCGAATCAACACTCGAGTGTTGATTCGGTATCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031888.1-702s1c1
Sequence:CCGGGCTATCGTATTTGGAGTGGAACTCGAGTTCCACTCCAAATACGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031888
PMCHL2 MISSION shRNA shRNA Plasmid DNA
pro-melanin-concentrating hormone-like 2, pseudogene
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031888.1-104s1c1
Sequence:CCGGCACTAGAAGGATCTGTAGCTTCTCGAGAAGCTACAGATCCTTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031888.1-664s1c1
Sequence:CCGGGCCTGTGTTCTGTAAAGAGAACTCGAGTTCTCTTTACAGAACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031888.1-148s1c1
Sequence:CCGGGATACCGAATCAACACTAGAACTCGAGTTCTAGTGTTGATTCGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031888.1-100s1c1
Sequence:CCGGCTTGCACTAGAAGGATCTGTACTCGAGTACAGATCCTTCTAGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031888.1-142s1c1
Sequence:CCGGGTTCAGGATACCGAATCAACACTCGAGTGTTGATTCGGTATCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031888.1-702s1c1
Sequence:CCGGGCTATCGTATTTGGAGTGGAACTCGAGTTCCACTCCAAATACGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031888
PMCHL2 MISSION shRNA Lentiviral Transduction Particles
pro-melanin-concentrating hormone-like 2, pseudogene
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031888.1-104s1c1
Sequence:CCGGCACTAGAAGGATCTGTAGCTTCTCGAGAAGCTACAGATCCTTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031888.1-664s1c1
Sequence:CCGGGCCTGTGTTCTGTAAAGAGAACTCGAGTTCTCTTTACAGAACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031888.1-148s1c1
Sequence:CCGGGATACCGAATCAACACTAGAACTCGAGTTCTAGTGTTGATTCGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031888.1-100s1c1
Sequence:CCGGCTTGCACTAGAAGGATCTGTACTCGAGTACAGATCCTTCTAGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031888.1-142s1c1
Sequence:CCGGGTTCAGGATACCGAATCAACACTCGAGTGTTGATTCGGTATCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031888.1-702s1c1
Sequence:CCGGGCTATCGTATTTGGAGTGGAACTCGAGTTCCACTCCAAATACGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks