EMAIL THIS PAGE TO A FRIEND

PMM2

phosphomannomutase 2

Synonyms: CDG1 CDG1a CDGS PMI PMI1 PMM 2
UniProtKB ID: O15305, A8K672, D3DUF3
Gene ID:
Human(5373) Summary: The protein encoded by this gene catalyzes the isomerization of mannose 6-phosphate to mannose 1-phosphate, which is a precursor to GDP-mannose necessary for the synthesis of dolichol-P-oligosaccharides. Mutations in this gene have been shown to cause defects in glycoprotein biosynthesis, which manifests as carbohydrate-deficient glycoprotein syndrome type I. [provided by RefSeq, Jul 2008]
Mouse(54128) phosphomannomutase 2
Rat(302915) phosphomannomutase 2
cow(510978) phosphomannomutase 2
sheep(101105711) phosphomannomutase 2
naked mole-rat(101713790) phosphomannomutase 2
domestic guinea pig(100725878) phosphomannomutase 2
Zebrafish(368229) phosphomannomutase 2
chicken(427679) phosphomannomutase 2
domestic cat(101088803) phosphomannomutase 2
dog(490013) phosphomannomutase 2
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000303 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000303 Rosetta Predictions human pricing
NM_001106973 Rosetta Predictions rat pricing
NM_016881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207784 predicted 232
2 SASI_Hs01_00207785 predicted 282
3 SASI_Hs02_00302289 predicted 523
4 SASI_Hs01_00207786 predicted 470
5 SASI_Hs01_00207787 predicted 406
6 SASI_Hs01_00207788 predicted 1047
7 SASI_Hs01_00207789 predicted 636
8 SASI_Hs01_00207790 predicted 473
9 SASI_Hs01_00207791 predicted 321
10 SASI_Hs02_00302290 predicted 988
11 SASI_Hs01_00207783 predicted 217
12 SASI_Hs01_00207792 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224236 predicted 575
2 SASI_Rn02_00224237 predicted 994
3 SASI_Rn02_00224238 predicted 232
4 SASI_Rn02_00224239 predicted 476
5 SASI_Rn02_00224240 predicted 644
6 SASI_Rn02_00224241 predicted 415
7 SASI_Rn02_00224242 predicted 615
8 SASI_Rn02_00224243 predicted 244
9 SASI_Rn02_00224244 predicted 933
10 SASI_Rn02_00224245 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175189 predicted 420
2 SASI_Mm01_00175190 predicted 648
3 SASI_Mm01_00175191 predicted 367
4 SASI_Mm01_00175192 predicted 616
5 SASI_Mm01_00175193 predicted 474
6 SASI_Mm02_00323694 predicted 464
7 SASI_Mm01_00175194 predicted 248
8 SASI_Mm01_00175195 predicted 866
9 SASI_Mm01_00175196 predicted 682
10 SASI_Mm01_00175197 predicted 346
11 SASI_Mm01_00175198 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016881
VALIDATED
PMM2 MISSION shRNA Bacterial Glycerol Stock
phosphomannomutase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016881.1-213s1c1
Sequence:CCGGCAAGAGCAACTGGGAAATGATCTCGAGATCATTTCCCAGTTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016881.1-651s1c1
Sequence:CCGGGCTGGCTATAAGACCATTTATCTCGAGATAAATGGTCTTATAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016881.1-939s1c1
Sequence:CCGGGCAGGAAGGAACACCACTATTCTCGAGAATAGTGGTGTTCCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016881.1-132s1c1
Sequence:CCGGGAAGAAATGGATGGCTTTCTACTCGAGTAGAAAGCCATCCATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016881.1-234s1c1
Sequence:CCGGGTGGTTGAGAAATACGATTATCTCGAGATAATCGTATTTCTCAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016881.1-293s1c1
Sequence:CCGGGAAGCTATTGTGTAAGCAGAACTCGAGTTCTGCTTACACAATAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016881.1-466s1c1
Sequence:CCGGGCCAAGAAGAACGAATTGAATCTCGAGATTCAATTCGTTCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016881.1-219s1c1
Sequence:CCGGCAACTGGGAAATGATGTGGTTCTCGAGAACCACATCATTTCCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016881.1-1094s1c1
Sequence:CCGGGCTGGCATCTCTATTTGCTATCTCGAGATAGCAAATAGAGATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016881
VALIDATED
PMM2 MISSION shRNA shRNA Plasmid DNA
phosphomannomutase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016881.1-213s1c1
Sequence:CCGGCAAGAGCAACTGGGAAATGATCTCGAGATCATTTCCCAGTTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016881.1-651s1c1
Sequence:CCGGGCTGGCTATAAGACCATTTATCTCGAGATAAATGGTCTTATAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016881.1-939s1c1
Sequence:CCGGGCAGGAAGGAACACCACTATTCTCGAGAATAGTGGTGTTCCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016881.1-132s1c1
Sequence:CCGGGAAGAAATGGATGGCTTTCTACTCGAGTAGAAAGCCATCCATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016881.1-234s1c1
Sequence:CCGGGTGGTTGAGAAATACGATTATCTCGAGATAATCGTATTTCTCAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016881.1-293s1c1
Sequence:CCGGGAAGCTATTGTGTAAGCAGAACTCGAGTTCTGCTTACACAATAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016881.1-466s1c1
Sequence:CCGGGCCAAGAAGAACGAATTGAATCTCGAGATTCAATTCGTTCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016881.1-219s1c1
Sequence:CCGGCAACTGGGAAATGATGTGGTTCTCGAGAACCACATCATTTCCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016881.1-1094s1c1
Sequence:CCGGGCTGGCATCTCTATTTGCTATCTCGAGATAGCAAATAGAGATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016881
VALIDATED
PMM2 MISSION shRNA Lentiviral Transduction Particles
phosphomannomutase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016881.1-213s1c1
Sequence:CCGGCAAGAGCAACTGGGAAATGATCTCGAGATCATTTCCCAGTTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016881.1-651s1c1
Sequence:CCGGGCTGGCTATAAGACCATTTATCTCGAGATAAATGGTCTTATAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016881.1-939s1c1
Sequence:CCGGGCAGGAAGGAACACCACTATTCTCGAGAATAGTGGTGTTCCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016881.1-132s1c1
Sequence:CCGGGAAGAAATGGATGGCTTTCTACTCGAGTAGAAAGCCATCCATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016881.1-234s1c1
Sequence:CCGGGTGGTTGAGAAATACGATTATCTCGAGATAATCGTATTTCTCAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016881.1-293s1c1
Sequence:CCGGGAAGCTATTGTGTAAGCAGAACTCGAGTTCTGCTTACACAATAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016881.1-466s1c1
Sequence:CCGGGCCAAGAAGAACGAATTGAATCTCGAGATTCAATTCGTTCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016881.1-219s1c1
Sequence:CCGGCAACTGGGAAATGATGTGGTTCTCGAGAACCACATCATTTCCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016881.1-1094s1c1
Sequence:CCGGGCTGGCATCTCTATTTGCTATCTCGAGATAGCAAATAGAGATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000303
PMM2 MISSION shRNA Bacterial Glycerol Stock
phosphomannomutase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-268s1c1
Sequence:CCGGGTAGCATACAAAGATGGGAAACTCGAGTTTCCCATCTTTGTATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-325s1c1
Sequence:CCGGGAGGCCCTAATCCAAGATTTACTCGAGTAAATCTTGGATTAGGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-466s1c1
Sequence:CCGGGAACGCATTGAGTTCTACGAACTCGAGTTCGTAGAACTCAATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-643s1c1
Sequence:CCGGGACGGTTATAAGACCATTTATCTCGAGATAAATGGTCTTATAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-127s1c1
Sequence:CCGGGAAATGGATGACTTCCTACAACTCGAGTTGTAGGAAGTCATCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-665s21c1
Sequence:CCGGGACGGTTATAAGACCATTTATCTCGAGATAAATGGTCTTATAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-347s21c1
Sequence:CCGGGAGGCCCTAATCCAAGATTTACTCGAGTAAATCTTGGATTAGGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-149s21c1
Sequence:CCGGGAAATGGATGACTTCCTACAACTCGAGTTGTAGGAAGTCATCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-488s21c1
Sequence:CCGGGAACGCATTGAGTTCTACGAACTCGAGTTCGTAGAACTCAATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-290s21c1
Sequence:CCGGGTAGCATACAAAGATGGGAAACTCGAGTTTCCCATCTTTGTATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000303
PMM2 MISSION shRNA shRNA Plasmid DNA
phosphomannomutase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-268s1c1
Sequence:CCGGGTAGCATACAAAGATGGGAAACTCGAGTTTCCCATCTTTGTATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-325s1c1
Sequence:CCGGGAGGCCCTAATCCAAGATTTACTCGAGTAAATCTTGGATTAGGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-466s1c1
Sequence:CCGGGAACGCATTGAGTTCTACGAACTCGAGTTCGTAGAACTCAATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-643s1c1
Sequence:CCGGGACGGTTATAAGACCATTTATCTCGAGATAAATGGTCTTATAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-127s1c1
Sequence:CCGGGAAATGGATGACTTCCTACAACTCGAGTTGTAGGAAGTCATCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-665s21c1
Sequence:CCGGGACGGTTATAAGACCATTTATCTCGAGATAAATGGTCTTATAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-347s21c1
Sequence:CCGGGAGGCCCTAATCCAAGATTTACTCGAGTAAATCTTGGATTAGGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-149s21c1
Sequence:CCGGGAAATGGATGACTTCCTACAACTCGAGTTGTAGGAAGTCATCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-488s21c1
Sequence:CCGGGAACGCATTGAGTTCTACGAACTCGAGTTCGTAGAACTCAATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-290s21c1
Sequence:CCGGGTAGCATACAAAGATGGGAAACTCGAGTTTCCCATCTTTGTATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000303
PMM2 MISSION shRNA Lentiviral Transduction Particles
phosphomannomutase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-268s1c1
Sequence:CCGGGTAGCATACAAAGATGGGAAACTCGAGTTTCCCATCTTTGTATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-325s1c1
Sequence:CCGGGAGGCCCTAATCCAAGATTTACTCGAGTAAATCTTGGATTAGGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-466s1c1
Sequence:CCGGGAACGCATTGAGTTCTACGAACTCGAGTTCGTAGAACTCAATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-643s1c1
Sequence:CCGGGACGGTTATAAGACCATTTATCTCGAGATAAATGGTCTTATAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000303.1-127s1c1
Sequence:CCGGGAAATGGATGACTTCCTACAACTCGAGTTGTAGGAAGTCATCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-665s21c1
Sequence:CCGGGACGGTTATAAGACCATTTATCTCGAGATAAATGGTCTTATAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-347s21c1
Sequence:CCGGGAGGCCCTAATCCAAGATTTACTCGAGTAAATCTTGGATTAGGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-149s21c1
Sequence:CCGGGAAATGGATGACTTCCTACAACTCGAGTTGTAGGAAGTCATCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-488s21c1
Sequence:CCGGGAACGCATTGAGTTCTACGAACTCGAGTTCGTAGAACTCAATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000303.2-290s21c1
Sequence:CCGGGTAGCATACAAAGATGGGAAACTCGAGTTTCCCATCTTTGTATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks