EMAIL THIS PAGE TO A FRIEND

PNMAL2

paraneoplastic Ma antigen family-like 2

UniProtKB ID: Q9ULN7, C9JGD5, Q08E79, Q0D2F9, Q6ZVD1
Gene ID:
Mouse(434128) PNMA-like 2
Rat(308393) paraneoplastic Ma antigen family-like 2
cow(100140571) PNMA-like 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA054810 Anti-PNMAL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020709 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020709 Rosetta Predictions human pricing
NM_001107481 Rosetta Predictions rat pricing
NM_001099636 Rosetta Predictions mouse pricing
XM_485870 Rosetta Predictions mouse pricing
XM_914713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353713 predicted 1262
2 SASI_Hs02_00353714 predicted 586
3 SASI_Hs02_00353715 predicted 943
4 SASI_Hs02_00353716 predicted 1195
5 SASI_Hs02_00353717 predicted 641
6 SASI_Hs02_00353718 predicted 2437
7 SASI_Hs02_00353719 predicted 2550
8 SASI_Hs02_00353720 predicted 937
9 SASI_Hs02_00353721 predicted 1560
10 SASI_Hs02_00353722 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229255 predicted 349
2 SASI_Rn02_00229256 predicted 2346
3 SASI_Rn02_00229257 predicted 1641
4 SASI_Rn02_00229258 predicted 616
5 SASI_Rn02_00229259 predicted 483
6 SASI_Rn02_00229260 predicted 678
7 SASI_Rn02_00229261 predicted 769
8 SASI_Rn02_00229262 predicted 2021
9 SASI_Rn02_00229263 predicted 1646
10 SASI_Rn02_00229264 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301905 predicted 413
2 SASI_Mm02_00301906 predicted 2016
3 SASI_Mm02_00301907 predicted 988
4 SASI_Mm02_00301908 predicted 1693
5 SASI_Mm02_00301909 predicted 685
6 SASI_Mm02_00301910 predicted 1911
7 SASI_Mm02_00301911 predicted 1729
8 SASI_Mm02_00301912 predicted 2062
9 SASI_Mm02_00301913 predicted 410
10 SASI_Mm02_00301914 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228997 predicted 417
2 SASI_Mm01_00228998 predicted 567
3 SASI_Mm01_00228999 predicted 566
4 SASI_Mm01_00229000 predicted 2142
5 SASI_Mm01_00229001 predicted 561
6 SASI_Mm01_00229002 predicted 2143
7 SASI_Mm01_00229003 predicted 546
8 SASI_Mm01_00229004 predicted 422
9 SASI_Mm01_00229005 predicted 468
10 SASI_Mm01_00229006 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438853 predicted 411
2 SASI_Mm02_00438854 predicted 2014
3 SASI_Mm02_00438855 predicted 985
4 SASI_Mm02_00438856 predicted 1689
5 SASI_Mm02_00438857 predicted 686
6 SASI_Mm02_00438858 predicted 1909
7 SASI_Mm02_00438859 predicted 1724
8 SASI_Mm02_00438860 predicted 2064
9 SASI_Mm02_00438861 predicted 408
10 SASI_Mm02_00438862 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099636
PNMAL2 MISSION shRNA Bacterial Glycerol Stock
paraneoplastic Ma antigen family-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-1913s21c1
Sequence:CCGGACCATAGCCAAGGTGGTTTATCTCGAGATAAACCACCTTGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-775s21c1
Sequence:CCGGATAGCCATCCCTCTGGTATTGCTCGAGCAATACCAGAGGGATGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-564s21c1
Sequence:CCGGTCGGACTGTGAGAGCTGTAACCTCGAGGTTACAGCTCTCACAGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-1464s21c1
Sequence:CCGGTGTGGCTATTGTGGCTTATACCTCGAGGTATAAGCCACAATAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-638s21c1
Sequence:CCGGCTGCCATACCTATCCACATTACTCGAGTAATGTGGATAGGTATGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099636
PNMAL2 MISSION shRNA shRNA Plasmid DNA
paraneoplastic Ma antigen family-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-1913s21c1
Sequence:CCGGACCATAGCCAAGGTGGTTTATCTCGAGATAAACCACCTTGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-775s21c1
Sequence:CCGGATAGCCATCCCTCTGGTATTGCTCGAGCAATACCAGAGGGATGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-564s21c1
Sequence:CCGGTCGGACTGTGAGAGCTGTAACCTCGAGGTTACAGCTCTCACAGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-1464s21c1
Sequence:CCGGTGTGGCTATTGTGGCTTATACCTCGAGGTATAAGCCACAATAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-638s21c1
Sequence:CCGGCTGCCATACCTATCCACATTACTCGAGTAATGTGGATAGGTATGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099636
PNMAL2 MISSION shRNA Lentiviral Transduction Particles
paraneoplastic Ma antigen family-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-1913s21c1
Sequence:CCGGACCATAGCCAAGGTGGTTTATCTCGAGATAAACCACCTTGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-775s21c1
Sequence:CCGGATAGCCATCCCTCTGGTATTGCTCGAGCAATACCAGAGGGATGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-564s21c1
Sequence:CCGGTCGGACTGTGAGAGCTGTAACCTCGAGGTTACAGCTCTCACAGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-1464s21c1
Sequence:CCGGTGTGGCTATTGTGGCTTATACCTCGAGGTATAAGCCACAATAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099636.1-638s21c1
Sequence:CCGGCTGCCATACCTATCCACATTACTCGAGTAATGTGGATAGGTATGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020709
PNMAL2 MISSION shRNA Bacterial Glycerol Stock
paraneoplastic Ma antigen family-like 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020709.1-1414s21c1
Sequence:CCGGGAAACAGAGGAGTTGGATAATCTCGAGATTATCCAACTCCTCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020709.1-650s21c1
Sequence:CCGGAGTTTGTGGAGGACGTCAATCCTCGAGGATTGACGTCCTCCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020709.1-3283s21c1
Sequence:CCGGGGCCTTGCAGCCCTTACTAAACTCGAGTTTAGTAAGGGCTGCAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020709.1-1214s21c1
Sequence:CCGGTGGTCACCGTCACCGACAAATCTCGAGATTTGTCGGTGACGGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020709
PNMAL2 MISSION shRNA shRNA Plasmid DNA
paraneoplastic Ma antigen family-like 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020709.1-1414s21c1
Sequence:CCGGGAAACAGAGGAGTTGGATAATCTCGAGATTATCCAACTCCTCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020709.1-650s21c1
Sequence:CCGGAGTTTGTGGAGGACGTCAATCCTCGAGGATTGACGTCCTCCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020709.1-3283s21c1
Sequence:CCGGGGCCTTGCAGCCCTTACTAAACTCGAGTTTAGTAAGGGCTGCAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020709.1-1214s21c1
Sequence:CCGGTGGTCACCGTCACCGACAAATCTCGAGATTTGTCGGTGACGGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020709
PNMAL2 MISSION shRNA Lentiviral Transduction Particles
paraneoplastic Ma antigen family-like 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020709.1-1414s21c1
Sequence:CCGGGAAACAGAGGAGTTGGATAATCTCGAGATTATCCAACTCCTCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020709.1-650s21c1
Sequence:CCGGAGTTTGTGGAGGACGTCAATCCTCGAGGATTGACGTCCTCCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020709.1-3283s21c1
Sequence:CCGGGGCCTTGCAGCCCTTACTAAACTCGAGTTTAGTAAGGGCTGCAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020709.1-1214s21c1
Sequence:CCGGTGGTCACCGTCACCGACAAATCTCGAGATTTGTCGGTGACGGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks