EMAIL THIS PAGE TO A FRIEND

PNO1

partner of NOB1 homolog (S. cerevisiae)

Synonyms: KHRBP1 RRP20
UniProtKB ID: Q9NRX1, A8K6Q0, Q53G13, Q8WVB8
Gene ID:
Mouse(66249) partner of NOB1 homolog (S. cerevisiae)
Rat(289809) partner of NOB1 homolog (S. cerevisiae)
Zebrafish(393520) partner of NOB1 homolog (S. cerevisiae)
domestic cat(101090093) partner of NOB1 homolog (S. cerevisiae)
dog(474623) partner of NOB1 homolog (S. cerevisiae)
chicken(769547) partner of NOB1 homolog (S. cerevisiae)
cow(360193) partner of NOB1 homolog (S. cerevisiae)
sheep(101111005) partner of NOB1 homolog (S. cerevisiae)
domestic guinea pig(100730450) partner of NOB1 homolog (S. cerevisiae)
naked mole-rat(101706631) partner of NOB1 homolog (S. cerevisiae)
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020143 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020143 Rosetta Predictions human pricing
NM_199083 Rosetta Predictions rat pricing
NM_025443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353031 predicted 310
2 SASI_Hs01_00216194 predicted 575
3 SASI_Hs01_00216196 predicted 435
4 SASI_Hs02_00353032 predicted 367
5 SASI_Hs01_00216198 predicted 333
6 SASI_Hs01_00216199 predicted 625
7 SASI_Hs01_00216200 predicted 890
8 SASI_Hs01_00216202 predicted 372
9 SASI_Hs02_00353033 predicted 430
10 SASI_Hs01_00216203 predicted 761
11 SASI_Hs01_00216195 predicted 308
12 SASI_Hs01_00216197 predicted 592
13 SASI_Hs01_00216201 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089521 predicted 1058
2 SASI_Rn01_00089522 predicted 799
3 SASI_Rn01_00089523 predicted 417
4 SASI_Rn01_00089524 predicted 346
5 SASI_Rn01_00089525 predicted 730
6 SASI_Rn01_00089526 predicted 713
7 SASI_Rn02_00270085 predicted 1013
8 SASI_Rn01_00089530 predicted 360
9 SASI_Rn02_00270086 predicted 341
10 SASI_Rn02_00270087 predicted 1054
11 SASI_Rn01_00089527 predicted 1025
12 SASI_Rn01_00089528 predicted 347
13 SASI_Rn01_00089529 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064008 predicted 468
2 SASI_Mm01_00064009 predicted 344
3 SASI_Mm01_00064010 predicted 312
4 SASI_Mm01_00064011 predicted 882
5 SASI_Mm01_00064012 predicted 384
6 SASI_Mm02_00328271 predicted 632
7 SASI_Mm01_00064014 predicted 726
8 SASI_Mm01_00064015 predicted 394
9 SASI_Mm01_00064016 predicted 669
10 SASI_Mm01_00064017 predicted 586
11 SASI_Mm01_00064013 predicted 724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020143
VALIDATED
PNO1 MISSION shRNA Bacterial Glycerol Stock
partner of NOB1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020143.2-371s21c1
Sequence:CCGGGGGACTTCAGATACGCTTTAACTCGAGTTAAAGCGTATCTGAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020143.2-766s21c1
Sequence:CCGGCCAAGGTTTATGGCAATATTCCTCGAGGAATATTGCCATAAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020143.2-1132s21c1
Sequence:CCGGACAGCTCTATATGGATTTATACTCGAGTATAAATCCATATAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020143.2-572s21c1
Sequence:CCGGCCTAAAGGGAGACCATCTATCCTCGAGGATAGATGGTCTCCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020143.2-340s21c1
Sequence:CCGGTGAAGATATTTACTCCTATTGCTCGAGCAATAGGAGTAAATATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020143.2-899s1c1
Sequence:CCGGGCTGAACAATTTCAGTCATTTCTCGAGAAATGACTGAAATTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020143.2-436s1c1
Sequence:CCGGAGGATGTTAGTGCTCTGACAACTCGAGTTGTCAGAGCACTAACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020143.2-581s1c1
Sequence:CCGGAGACCATCTATCCAGGGCAATCTCGAGATTGCCCTGGATAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020143.2-313s1c1
Sequence:CCGGGATACACACCATTGAAAGAAACTCGAGTTTCTTTCAATGGTGTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020143.2-778s1c1
Sequence:CCGGGCAATATTCGAGCTGTGGCTACTCGAGTAGCCACAGCTCGAATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020143
VALIDATED
PNO1 MISSION shRNA shRNA Plasmid DNA
partner of NOB1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020143.2-371s21c1
Sequence:CCGGGGGACTTCAGATACGCTTTAACTCGAGTTAAAGCGTATCTGAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020143.2-766s21c1
Sequence:CCGGCCAAGGTTTATGGCAATATTCCTCGAGGAATATTGCCATAAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020143.2-1132s21c1
Sequence:CCGGACAGCTCTATATGGATTTATACTCGAGTATAAATCCATATAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020143.2-572s21c1
Sequence:CCGGCCTAAAGGGAGACCATCTATCCTCGAGGATAGATGGTCTCCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020143.2-340s21c1
Sequence:CCGGTGAAGATATTTACTCCTATTGCTCGAGCAATAGGAGTAAATATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020143.2-899s1c1
Sequence:CCGGGCTGAACAATTTCAGTCATTTCTCGAGAAATGACTGAAATTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020143.2-436s1c1
Sequence:CCGGAGGATGTTAGTGCTCTGACAACTCGAGTTGTCAGAGCACTAACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020143.2-581s1c1
Sequence:CCGGAGACCATCTATCCAGGGCAATCTCGAGATTGCCCTGGATAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020143.2-313s1c1
Sequence:CCGGGATACACACCATTGAAAGAAACTCGAGTTTCTTTCAATGGTGTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020143.2-778s1c1
Sequence:CCGGGCAATATTCGAGCTGTGGCTACTCGAGTAGCCACAGCTCGAATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020143
VALIDATED
PNO1 MISSION shRNA Lentiviral Transduction Particles
partner of NOB1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020143.2-371s21c1
Sequence:CCGGGGGACTTCAGATACGCTTTAACTCGAGTTAAAGCGTATCTGAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020143.2-766s21c1
Sequence:CCGGCCAAGGTTTATGGCAATATTCCTCGAGGAATATTGCCATAAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020143.2-1132s21c1
Sequence:CCGGACAGCTCTATATGGATTTATACTCGAGTATAAATCCATATAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020143.2-572s21c1
Sequence:CCGGCCTAAAGGGAGACCATCTATCCTCGAGGATAGATGGTCTCCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020143.2-340s21c1
Sequence:CCGGTGAAGATATTTACTCCTATTGCTCGAGCAATAGGAGTAAATATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020143.2-899s1c1
Sequence:CCGGGCTGAACAATTTCAGTCATTTCTCGAGAAATGACTGAAATTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020143.2-436s1c1
Sequence:CCGGAGGATGTTAGTGCTCTGACAACTCGAGTTGTCAGAGCACTAACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020143.2-581s1c1
Sequence:CCGGAGACCATCTATCCAGGGCAATCTCGAGATTGCCCTGGATAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020143.2-313s1c1
Sequence:CCGGGATACACACCATTGAAAGAAACTCGAGTTTCTTTCAATGGTGTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020143.2-778s1c1
Sequence:CCGGGCAATATTCGAGCTGTGGCTACTCGAGTAGCCACAGCTCGAATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025443
VALIDATED
PNO1 MISSION shRNA Bacterial Glycerol Stock
partner of NOB1 homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025443.2-379s1c1
Sequence:CCGGGGGACTTCAGATACGCTTTAACTCGAGTTAAAGCGTATCTGAAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025443.2-727s21c1
Sequence:CCGGGATGGCAAGAACAGCTATTTGCTCGAGCAAATAGCTGTTCTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025443.2-962s21c1
Sequence:CCGGGCTGCTTCTAGGATAATTTAACTCGAGTTAAATTATCCTAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025443.2-1205s21c1
Sequence:CCGGCATGGCAGAAACTTGCACTATCTCGAGATAGTGCAAGTTTCTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025443.2-378s21c1
Sequence:CCGGTGGGACTTCAGATACGCTTTACTCGAGTAAAGCGTATCTGAAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025443.1-495s1c1
Sequence:CCGGCGACTAGATGACCTCTTCCTACTCGAGTAGGAAGAGGTCATCTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177397    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025443.1-927s1c1
Sequence:CCGGGCTGCTTCTAGGATAATTTAACTCGAGTTAAATTATCCTAGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025443.1-438s1c1
Sequence:CCGGGACTTTGTGAAAGCCTTTGTTCTCGAGAACAAAGGCTTTCACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025443.1-1170s1c1
Sequence:CCGGCATGGCAGAAACTTGCACTATCTCGAGATAGTGCAAGTTTCTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025443.1-705s1c1
Sequence:CCGGGCTATTTGCAACCTCATCCTACTCGAGTAGGATGAGGTTGCAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025443.1-735s1c1
Sequence:CCGGCCATCAAAGGTGTATGGCAATCTCGAGATTGCCATACACCTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025443.1-659s1c1
Sequence:CCGGCGTTCACATTCTTGGCTCTTTCTCGAGAAAGAGCCAAGAATGTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025443
VALIDATED
PNO1 MISSION shRNA shRNA Plasmid DNA
partner of NOB1 homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025443.2-379s1c1
Sequence:CCGGGGGACTTCAGATACGCTTTAACTCGAGTTAAAGCGTATCTGAAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025443.2-727s21c1
Sequence:CCGGGATGGCAAGAACAGCTATTTGCTCGAGCAAATAGCTGTTCTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025443.2-962s21c1
Sequence:CCGGGCTGCTTCTAGGATAATTTAACTCGAGTTAAATTATCCTAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025443.2-1205s21c1
Sequence:CCGGCATGGCAGAAACTTGCACTATCTCGAGATAGTGCAAGTTTCTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025443.2-378s21c1
Sequence:CCGGTGGGACTTCAGATACGCTTTACTCGAGTAAAGCGTATCTGAAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025443.1-495s1c1
Sequence:CCGGCGACTAGATGACCTCTTCCTACTCGAGTAGGAAGAGGTCATCTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177397    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025443.1-927s1c1
Sequence:CCGGGCTGCTTCTAGGATAATTTAACTCGAGTTAAATTATCCTAGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025443.1-438s1c1
Sequence:CCGGGACTTTGTGAAAGCCTTTGTTCTCGAGAACAAAGGCTTTCACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025443.1-1170s1c1
Sequence:CCGGCATGGCAGAAACTTGCACTATCTCGAGATAGTGCAAGTTTCTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025443.1-705s1c1
Sequence:CCGGGCTATTTGCAACCTCATCCTACTCGAGTAGGATGAGGTTGCAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025443.1-735s1c1
Sequence:CCGGCCATCAAAGGTGTATGGCAATCTCGAGATTGCCATACACCTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025443.1-659s1c1
Sequence:CCGGCGTTCACATTCTTGGCTCTTTCTCGAGAAAGAGCCAAGAATGTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025443
VALIDATED
PNO1 MISSION shRNA Lentiviral Transduction Particles
partner of NOB1 homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025443.2-379s1c1
Sequence:CCGGGGGACTTCAGATACGCTTTAACTCGAGTTAAAGCGTATCTGAAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025443.2-727s21c1
Sequence:CCGGGATGGCAAGAACAGCTATTTGCTCGAGCAAATAGCTGTTCTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025443.2-962s21c1
Sequence:CCGGGCTGCTTCTAGGATAATTTAACTCGAGTTAAATTATCCTAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025443.2-1205s21c1
Sequence:CCGGCATGGCAGAAACTTGCACTATCTCGAGATAGTGCAAGTTTCTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025443.2-378s21c1
Sequence:CCGGTGGGACTTCAGATACGCTTTACTCGAGTAAAGCGTATCTGAAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025443.1-495s1c1
Sequence:CCGGCGACTAGATGACCTCTTCCTACTCGAGTAGGAAGAGGTCATCTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177397    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025443.1-927s1c1
Sequence:CCGGGCTGCTTCTAGGATAATTTAACTCGAGTTAAATTATCCTAGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025443.1-438s1c1
Sequence:CCGGGACTTTGTGAAAGCCTTTGTTCTCGAGAACAAAGGCTTTCACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025443.1-1170s1c1
Sequence:CCGGCATGGCAGAAACTTGCACTATCTCGAGATAGTGCAAGTTTCTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025443.1-705s1c1
Sequence:CCGGGCTATTTGCAACCTCATCCTACTCGAGTAGGATGAGGTTGCAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025443.1-735s1c1
Sequence:CCGGCCATCAAAGGTGTATGGCAATCTCGAGATTGCCATACACCTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025443.1-659s1c1
Sequence:CCGGCGTTCACATTCTTGGCTCTTTCTCGAGAAAGAGCCAAGAATGTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks