EMAIL THIS PAGE TO A FRIEND

PNPLA8

patatin-like phospholipase domain containing 8

Synonyms: IPLA2(GAMMA) IPLA2-2 IPLA2G iPLA2gamma
Gene ID:
Human(50640) Summary: This gene encodes a member of the patatin-like phospholipase domain containing protein family. Members of this family are phospholipases which catalyze the cleavage of fatty acids from membrane phospholipids. The product of this gene is a calcium-independent phospholipase. A pseudogene of this gene is located on the X chromosome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(67452) patatin-like phospholipase domain containing 8
Rat(314075) patatin-like phospholipase domain containing 8
Zebrafish(100126812) patatin-like phospholipase domain containing 8
chicken(417785) patatin-like phospholipase domain containing 8
Horse(100060568) patatin-like phospholipase domain containing 8
domestic cat(101101296) patatin-like phospholipase domain containing 8
dog(475880) patatin-like phospholipase domain containing 8
domestic guinea pig(100720063) patatin-like phospholipase domain containing 8
naked mole-rat(101725854) patatin-like phospholipase domain containing 8
Domestic Rabbit(100328577) patatin-like phospholipase domain containing 8
cow(535496) patatin-like phospholipase domain containing 8
sheep(101106930) patatin-like phospholipase domain containing 8
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015723 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015723 Rosetta Predictions human pricing
NM_001108020 Rosetta Predictions rat pricing
NM_026164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108358 predicted 2100
2 SASI_Hs01_00108359 predicted 2091
3 SASI_Hs01_00108360 predicted 1651
4 SASI_Hs01_00108362 predicted 2397
5 SASI_Hs02_00348412 predicted 2263
6 SASI_Hs01_00108363 predicted 1605
7 SASI_Hs01_00108364 predicted 1296
8 SASI_Hs02_00348413 predicted 2315
9 SASI_Hs01_00108366 predicted 2158
10 SASI_Hs01_00108367 predicted 1856
11 SASI_Hs01_00108361 predicted 1502
12 SASI_Hs01_00108365 predicted 2247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234575 predicted 983
2 SASI_Rn02_00234576 predicted 1320
3 SASI_Rn02_00234577 predicted 1385
4 SASI_Rn02_00234578 predicted 1275
5 SASI_Rn02_00234579 predicted 744
6 SASI_Rn02_00234580 predicted 1083
7 SASI_Rn02_00234581 predicted 265
8 SASI_Rn02_00234582 predicted 317
9 SASI_Rn02_00234583 predicted 423
10 SASI_Rn02_00234584 predicted 1252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093798 predicted 2077
2 SASI_Mm01_00093799 predicted 1351
3 SASI_Mm02_00329790 predicted 1616
4 SASI_Mm01_00093800 predicted 1465
5 SASI_Mm01_00093801 predicted 1114
6 SASI_Mm01_00093803 predicted 371
7 SASI_Mm01_00093804 predicted 1902
8 SASI_Mm01_00093805 predicted 1305
9 SASI_Mm02_00329791 predicted 1838
10 SASI_Mm01_00093806 predicted 1640
11 SASI_Mm01_00093802 predicted 2698
12 SASI_Mm01_00093807 predicted 1251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026164
VALIDATED
PNPLA8 MISSION shRNA Bacterial Glycerol Stock
patatin-like phospholipase domain containing 8
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026164.1-789s1c1
Sequence:CCGGCACCAGATTTGGAGAGTCATTCTCGAGAATGACTCTCCAAATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026164.1-2941s1c1
Sequence:CCGGCCACAATCCATGTGTTACTTTCTCGAGAAAGTAACACATGGATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026164.1-426s1c1
Sequence:CCGGCCATGGCTTACACTTTGGAATCTCGAGATTCCAAAGTGTAAGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026164.1-1874s1c1
Sequence:CCGGCTGCTATAAGTACCATAGTAACTCGAGTTACTATGGTACTTATAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026164.1-1307s1c1
Sequence:CCGGCCGACCCAAAGCTCTGTATTACTCGAGTAATACAGAGCTTTGGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026164.1-788s1c1
Sequence:CCGGCCACCAGATTTGGAGAGTCATCTCGAGATGACTCTCCAAATCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026164.1-1417s1c1
Sequence:CCGGCGGCTGAGACAAGTTAAGGATCTCGAGATCCTTAACTTGTCTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026164.1-253s1c1
Sequence:CCGGGCAAGAAGTCTTTGTGGGAAACTCGAGTTTCCCACAAAGACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026164.1-2858s1c1
Sequence:CCGGCGTTTCAATCATGTGGAATTTCTCGAGAAATTCCACATGATTGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026164.1-2907s1c1
Sequence:CCGGCCATTTACACTACTTAGCATTCTCGAGAATGCTAAGTAGTGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026164.2-821s21c1
Sequence:CCGGCCACCAGATTTGGAGAGTCATCTCGAGATGACTCTCCAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026164.2-1340s21c1
Sequence:CCGGCCGACCCAAAGCTCTGTATTACTCGAGTAATACAGAGCTTTGGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026164.2-2940s21c1
Sequence:CCGGCCATTTACACTACTTAGCATTCTCGAGAATGCTAAGTAGTGTAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026164.2-2891s21c1
Sequence:CCGGCGTTTCAATCATGTGGAATTTCTCGAGAAATTCCACATGATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026164.2-286s21c1
Sequence:CCGGGCAAGAAGTCTTTGTGGGAAACTCGAGTTTCCCACAAAGACTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026164
VALIDATED
PNPLA8 MISSION shRNA shRNA Plasmid DNA
patatin-like phospholipase domain containing 8
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026164.1-789s1c1
Sequence:CCGGCACCAGATTTGGAGAGTCATTCTCGAGAATGACTCTCCAAATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026164.1-2941s1c1
Sequence:CCGGCCACAATCCATGTGTTACTTTCTCGAGAAAGTAACACATGGATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026164.1-426s1c1
Sequence:CCGGCCATGGCTTACACTTTGGAATCTCGAGATTCCAAAGTGTAAGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026164.1-1874s1c1
Sequence:CCGGCTGCTATAAGTACCATAGTAACTCGAGTTACTATGGTACTTATAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026164.1-1307s1c1
Sequence:CCGGCCGACCCAAAGCTCTGTATTACTCGAGTAATACAGAGCTTTGGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026164.1-788s1c1
Sequence:CCGGCCACCAGATTTGGAGAGTCATCTCGAGATGACTCTCCAAATCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026164.1-1417s1c1
Sequence:CCGGCGGCTGAGACAAGTTAAGGATCTCGAGATCCTTAACTTGTCTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026164.1-253s1c1
Sequence:CCGGGCAAGAAGTCTTTGTGGGAAACTCGAGTTTCCCACAAAGACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026164.1-2858s1c1
Sequence:CCGGCGTTTCAATCATGTGGAATTTCTCGAGAAATTCCACATGATTGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026164.1-2907s1c1
Sequence:CCGGCCATTTACACTACTTAGCATTCTCGAGAATGCTAAGTAGTGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026164.2-821s21c1
Sequence:CCGGCCACCAGATTTGGAGAGTCATCTCGAGATGACTCTCCAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026164.2-1340s21c1
Sequence:CCGGCCGACCCAAAGCTCTGTATTACTCGAGTAATACAGAGCTTTGGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026164.2-2940s21c1
Sequence:CCGGCCATTTACACTACTTAGCATTCTCGAGAATGCTAAGTAGTGTAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026164.2-2891s21c1
Sequence:CCGGCGTTTCAATCATGTGGAATTTCTCGAGAAATTCCACATGATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026164.2-286s21c1
Sequence:CCGGGCAAGAAGTCTTTGTGGGAAACTCGAGTTTCCCACAAAGACTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026164
VALIDATED
PNPLA8 MISSION shRNA Lentiviral Transduction Particles
patatin-like phospholipase domain containing 8
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026164.1-789s1c1
Sequence:CCGGCACCAGATTTGGAGAGTCATTCTCGAGAATGACTCTCCAAATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026164.1-2941s1c1
Sequence:CCGGCCACAATCCATGTGTTACTTTCTCGAGAAAGTAACACATGGATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026164.1-426s1c1
Sequence:CCGGCCATGGCTTACACTTTGGAATCTCGAGATTCCAAAGTGTAAGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026164.1-1874s1c1
Sequence:CCGGCTGCTATAAGTACCATAGTAACTCGAGTTACTATGGTACTTATAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026164.1-1307s1c1
Sequence:CCGGCCGACCCAAAGCTCTGTATTACTCGAGTAATACAGAGCTTTGGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026164.1-788s1c1
Sequence:CCGGCCACCAGATTTGGAGAGTCATCTCGAGATGACTCTCCAAATCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026164.1-1417s1c1
Sequence:CCGGCGGCTGAGACAAGTTAAGGATCTCGAGATCCTTAACTTGTCTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026164.1-253s1c1
Sequence:CCGGGCAAGAAGTCTTTGTGGGAAACTCGAGTTTCCCACAAAGACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026164.1-2858s1c1
Sequence:CCGGCGTTTCAATCATGTGGAATTTCTCGAGAAATTCCACATGATTGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026164.1-2907s1c1
Sequence:CCGGCCATTTACACTACTTAGCATTCTCGAGAATGCTAAGTAGTGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026164.2-821s21c1
Sequence:CCGGCCACCAGATTTGGAGAGTCATCTCGAGATGACTCTCCAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026164.2-1340s21c1
Sequence:CCGGCCGACCCAAAGCTCTGTATTACTCGAGTAATACAGAGCTTTGGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026164.2-2940s21c1
Sequence:CCGGCCATTTACACTACTTAGCATTCTCGAGAATGCTAAGTAGTGTAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026164.2-2891s21c1
Sequence:CCGGCGTTTCAATCATGTGGAATTTCTCGAGAAATTCCACATGATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026164.2-286s21c1
Sequence:CCGGGCAAGAAGTCTTTGTGGGAAACTCGAGTTTCCCACAAAGACTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015723
VALIDATED
PNPLA8 MISSION shRNA Bacterial Glycerol Stock
patatin-like phospholipase domain containing 8
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015723.2-3066s1c1
Sequence:CCGGCGAACAAGAAACCGAAAGCTACTCGAGTAGCTTTCGGTTTCTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015723.2-1497s1c1
Sequence:CCGGCGGGCATTAGTTCAGGCATTACTCGAGTAATGCCTGAACTAATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015723.2-2241s1c1
Sequence:CCGGCCAGGCTACTTTGCAGAATATCTCGAGATATTCTGCAAAGTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015723.2-2107s1c1
Sequence:CCGGCCATAGTAAATAGAGGGATAACTCGAGTTATCCCTCTATTTACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015723.2-510s1c1
Sequence:CCGGCCTAAGCATTACTGGAGGATACTCGAGTATCCTCCAGTAATGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-2990s21c1
Sequence:CCGGCCTTACTGTGCTAGTAGATTTCTCGAGAAATCTACTAGCACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-2357s21c1
Sequence:CCGGGCCGTTAGAGTGCATAGTATCCTCGAGGATACTATGCACTCTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-1290s21c1
Sequence:CCGGACGGAAGGTGTACAAGCTTTACTCGAGTAAAGCTTGTACACCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-1499s21c1
Sequence:CCGGGGCATTAGTTCAGGCATTAAGCTCGAGCTTAATGCCTGAACTAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-701s21c1
Sequence:CCGGCATTTGTATGTCCCGTATTAACTCGAGTTAATACGGGACATACAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-1465s21c1
Sequence:CCGGTTATCGCAAGGGTGAGTATTGCTCGAGCAATACTCACCCTTGCGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015723
VALIDATED
PNPLA8 MISSION shRNA shRNA Plasmid DNA
patatin-like phospholipase domain containing 8
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015723.2-3066s1c1
Sequence:CCGGCGAACAAGAAACCGAAAGCTACTCGAGTAGCTTTCGGTTTCTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015723.2-1497s1c1
Sequence:CCGGCGGGCATTAGTTCAGGCATTACTCGAGTAATGCCTGAACTAATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015723.2-2241s1c1
Sequence:CCGGCCAGGCTACTTTGCAGAATATCTCGAGATATTCTGCAAAGTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015723.2-2107s1c1
Sequence:CCGGCCATAGTAAATAGAGGGATAACTCGAGTTATCCCTCTATTTACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015723.2-510s1c1
Sequence:CCGGCCTAAGCATTACTGGAGGATACTCGAGTATCCTCCAGTAATGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-2990s21c1
Sequence:CCGGCCTTACTGTGCTAGTAGATTTCTCGAGAAATCTACTAGCACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-2357s21c1
Sequence:CCGGGCCGTTAGAGTGCATAGTATCCTCGAGGATACTATGCACTCTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-1290s21c1
Sequence:CCGGACGGAAGGTGTACAAGCTTTACTCGAGTAAAGCTTGTACACCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-1499s21c1
Sequence:CCGGGGCATTAGTTCAGGCATTAAGCTCGAGCTTAATGCCTGAACTAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-701s21c1
Sequence:CCGGCATTTGTATGTCCCGTATTAACTCGAGTTAATACGGGACATACAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-1465s21c1
Sequence:CCGGTTATCGCAAGGGTGAGTATTGCTCGAGCAATACTCACCCTTGCGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015723
VALIDATED
PNPLA8 MISSION shRNA Lentiviral Transduction Particles
patatin-like phospholipase domain containing 8
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015723.2-3066s1c1
Sequence:CCGGCGAACAAGAAACCGAAAGCTACTCGAGTAGCTTTCGGTTTCTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015723.2-1497s1c1
Sequence:CCGGCGGGCATTAGTTCAGGCATTACTCGAGTAATGCCTGAACTAATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015723.2-2241s1c1
Sequence:CCGGCCAGGCTACTTTGCAGAATATCTCGAGATATTCTGCAAAGTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015723.2-2107s1c1
Sequence:CCGGCCATAGTAAATAGAGGGATAACTCGAGTTATCCCTCTATTTACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015723.2-510s1c1
Sequence:CCGGCCTAAGCATTACTGGAGGATACTCGAGTATCCTCCAGTAATGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-2990s21c1
Sequence:CCGGCCTTACTGTGCTAGTAGATTTCTCGAGAAATCTACTAGCACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-2357s21c1
Sequence:CCGGGCCGTTAGAGTGCATAGTATCCTCGAGGATACTATGCACTCTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-1290s21c1
Sequence:CCGGACGGAAGGTGTACAAGCTTTACTCGAGTAAAGCTTGTACACCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-1499s21c1
Sequence:CCGGGGCATTAGTTCAGGCATTAAGCTCGAGCTTAATGCCTGAACTAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-701s21c1
Sequence:CCGGCATTTGTATGTCCCGTATTAACTCGAGTTAATACGGGACATACAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015723.2-1465s21c1
Sequence:CCGGTTATCGCAAGGGTGAGTATTGCTCGAGCAATACTCACCCTTGCGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks