EMAIL THIS PAGE TO A FRIEND

PNRC2

proline-rich nuclear receptor coactivator 2

UniProtKB ID: Q9NPJ4, B4DU72
Gene ID:
Mouse(52830) proline-rich nuclear receptor coactivator 2
Rat(100125373) proline-rich nuclear receptor coactivator 2
domestic guinea pig(100713016) proline-rich nuclear receptor coactivator 2
naked mole-rat(101718334) proline-rich nuclear receptor coactivator 2
Domestic Rabbit(100344584) proline-rich nuclear receptor coactivator 2
cow(767836) proline-rich nuclear receptor coactivator 2
sheep(101118675) proline-rich nuclear receptor coactivator 2
Zebrafish(565522) proline-rich nuclear receptor coactivator 2
chicken(419688) proline-rich nuclear receptor coactivator 2
domestic cat(101100494) proline-rich nuclear receptor coactivator 2
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017761 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017761 Rosetta Predictions human pricing
NM_001103360 Rosetta Predictions rat pricing
NM_026383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244065 predicted 481
2 SASI_Hs01_00244066 predicted 1199
3 SASI_Hs01_00244067 predicted 457
4 SASI_Hs01_00244068 predicted 443
5 SASI_Hs01_00244069 predicted 505
6 SASI_Hs01_00244070 predicted 1108
7 SASI_Hs01_00244072 predicted 1290
8 SASI_Hs01_00244073 predicted 1294
9 SASI_Hs01_00244074 predicted 416
10 SASI_Hs02_00350586 predicted 1198
11 SASI_Hs01_00244071 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211586 predicted 798
2 SASI_Rn02_00211587 predicted 869
3 SASI_Rn02_00211588 predicted 962
4 SASI_Rn02_00211589 predicted 906
5 SASI_Rn02_00211590 predicted 954
6 SASI_Rn02_00211591 predicted 731
7 SASI_Rn02_00211592 predicted 572
8 SASI_Rn02_00211593 predicted 1074
9 SASI_Rn02_00211594 predicted 985
10 SASI_Rn02_00211595 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044159 predicted 772
2 SASI_Mm01_00044160 predicted 895
3 SASI_Mm01_00044162 predicted 801
4 SASI_Mm01_00044163 predicted 646
5 SASI_Mm01_00044164 predicted 812
6 SASI_Mm01_00044165 predicted 485
7 SASI_Mm01_00044167 predicted 776
8 SASI_Mm01_00044168 predicted 874
9 SASI_Mm02_00330134 predicted 829
10 SASI_Mm02_00330135 predicted 789
11 SASI_Mm01_00044161 predicted 842
12 SASI_Mm01_00044166 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017761
PNRC2 MISSION shRNA Bacterial Glycerol Stock
proline-rich nuclear receptor coactivator 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-485s1c1
Sequence:CCGGCCAGATGAAGATTGTTCATAACTCGAGTTATGAACAATCTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-670s1c1
Sequence:CCGGCCAAATTTAGTGAGCCGCCATCTCGAGATGGCGGCTCACTAAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-452s1c1
Sequence:CCGGGCTTAACAGACAGAAGACCAACTCGAGTTGGTCTTCTGTCTGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-781s1c1
Sequence:CCGGCCTTACTTAAAGTACAGGTATCTCGAGATACCTGTACTTTAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-732s1c1
Sequence:CCGGGTTTCCTTTAATCCTTCAGATCTCGAGATCTGAAGGATTAAAGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017761.3-1148s21c1
Sequence:CCGGAGTTGGTGAATCGGATTATAACTCGAGTTATAATCCGATTCACCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017761.3-542s21c1
Sequence:CCGGGAAAGAGGACATGGTTATAACCTCGAGGTTATAACCATGTCCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017761.3-977s21c1
Sequence:CCGGGTAGTATCAGTGCAACTTAAACTCGAGTTTAAGTTGCACTGATACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017761
PNRC2 MISSION shRNA shRNA Plasmid DNA
proline-rich nuclear receptor coactivator 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-485s1c1
Sequence:CCGGCCAGATGAAGATTGTTCATAACTCGAGTTATGAACAATCTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-670s1c1
Sequence:CCGGCCAAATTTAGTGAGCCGCCATCTCGAGATGGCGGCTCACTAAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-452s1c1
Sequence:CCGGGCTTAACAGACAGAAGACCAACTCGAGTTGGTCTTCTGTCTGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-781s1c1
Sequence:CCGGCCTTACTTAAAGTACAGGTATCTCGAGATACCTGTACTTTAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-732s1c1
Sequence:CCGGGTTTCCTTTAATCCTTCAGATCTCGAGATCTGAAGGATTAAAGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017761.3-1148s21c1
Sequence:CCGGAGTTGGTGAATCGGATTATAACTCGAGTTATAATCCGATTCACCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017761.3-542s21c1
Sequence:CCGGGAAAGAGGACATGGTTATAACCTCGAGGTTATAACCATGTCCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017761.3-977s21c1
Sequence:CCGGGTAGTATCAGTGCAACTTAAACTCGAGTTTAAGTTGCACTGATACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017761
PNRC2 MISSION shRNA Lentiviral Transduction Particles
proline-rich nuclear receptor coactivator 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-485s1c1
Sequence:CCGGCCAGATGAAGATTGTTCATAACTCGAGTTATGAACAATCTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-670s1c1
Sequence:CCGGCCAAATTTAGTGAGCCGCCATCTCGAGATGGCGGCTCACTAAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-452s1c1
Sequence:CCGGGCTTAACAGACAGAAGACCAACTCGAGTTGGTCTTCTGTCTGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-781s1c1
Sequence:CCGGCCTTACTTAAAGTACAGGTATCTCGAGATACCTGTACTTTAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017761.2-732s1c1
Sequence:CCGGGTTTCCTTTAATCCTTCAGATCTCGAGATCTGAAGGATTAAAGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017761.3-1148s21c1
Sequence:CCGGAGTTGGTGAATCGGATTATAACTCGAGTTATAATCCGATTCACCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017761.3-542s21c1
Sequence:CCGGGAAAGAGGACATGGTTATAACCTCGAGGTTATAACCATGTCCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017761.3-977s21c1
Sequence:CCGGGTAGTATCAGTGCAACTTAAACTCGAGTTTAAGTTGCACTGATACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026383
VALIDATED
PNRC2 MISSION shRNA Bacterial Glycerol Stock
proline-rich nuclear receptor coactivator 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-1167s1c1
Sequence:CCGGCCAGAGATGTACCAAGTCTATCTCGAGATAGACTTGGTACATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-485s1c1
Sequence:CCGGCCAGACGAAGATTGCTCATAACTCGAGTTATGAGCAATCTTCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-781s1c1
Sequence:CCGGCCTTACTTAAGGTACAGGTATCTCGAGATACCTGTACCTTAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-670s1c1
Sequence:CCGGCCAAATTTAGTGAACCACCATCTCGAGATGGTGGTTCACTAAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-743s1c1
Sequence:CCGGCCCTTCAGATAAGGAAACGATCTCGAGATCGTTTCCTTATCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-405s21c1
Sequence:CCGGCCAGACCCTCAATCTAGAAATCTCGAGATTTCTAGATTGAGGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-640s21c1
Sequence:CCGGCTCAAGCTAGTCAGAACTATGCTCGAGCATAGTTCTGACTAGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-1232s21c1
Sequence:CCGGGATCCTGGCCTCACCTATATACTCGAGTATATAGGTGAGGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-711s21c1
Sequence:CCGGCCAAGCCACTGGGTTCATGTTCTCGAGAACATGAACCCAGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-510s21c1
Sequence:CCGGGAACGAGGACATGGGTACAATCTCGAGATTGTACCCATGTCCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026383
VALIDATED
PNRC2 MISSION shRNA shRNA Plasmid DNA
proline-rich nuclear receptor coactivator 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-1167s1c1
Sequence:CCGGCCAGAGATGTACCAAGTCTATCTCGAGATAGACTTGGTACATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-485s1c1
Sequence:CCGGCCAGACGAAGATTGCTCATAACTCGAGTTATGAGCAATCTTCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-781s1c1
Sequence:CCGGCCTTACTTAAGGTACAGGTATCTCGAGATACCTGTACCTTAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-670s1c1
Sequence:CCGGCCAAATTTAGTGAACCACCATCTCGAGATGGTGGTTCACTAAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-743s1c1
Sequence:CCGGCCCTTCAGATAAGGAAACGATCTCGAGATCGTTTCCTTATCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-405s21c1
Sequence:CCGGCCAGACCCTCAATCTAGAAATCTCGAGATTTCTAGATTGAGGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-640s21c1
Sequence:CCGGCTCAAGCTAGTCAGAACTATGCTCGAGCATAGTTCTGACTAGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-1232s21c1
Sequence:CCGGGATCCTGGCCTCACCTATATACTCGAGTATATAGGTGAGGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-711s21c1
Sequence:CCGGCCAAGCCACTGGGTTCATGTTCTCGAGAACATGAACCCAGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-510s21c1
Sequence:CCGGGAACGAGGACATGGGTACAATCTCGAGATTGTACCCATGTCCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026383
VALIDATED
PNRC2 MISSION shRNA Lentiviral Transduction Particles
proline-rich nuclear receptor coactivator 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-1167s1c1
Sequence:CCGGCCAGAGATGTACCAAGTCTATCTCGAGATAGACTTGGTACATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-485s1c1
Sequence:CCGGCCAGACGAAGATTGCTCATAACTCGAGTTATGAGCAATCTTCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-781s1c1
Sequence:CCGGCCTTACTTAAGGTACAGGTATCTCGAGATACCTGTACCTTAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-670s1c1
Sequence:CCGGCCAAATTTAGTGAACCACCATCTCGAGATGGTGGTTCACTAAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026383.1-743s1c1
Sequence:CCGGCCCTTCAGATAAGGAAACGATCTCGAGATCGTTTCCTTATCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-405s21c1
Sequence:CCGGCCAGACCCTCAATCTAGAAATCTCGAGATTTCTAGATTGAGGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-640s21c1
Sequence:CCGGCTCAAGCTAGTCAGAACTATGCTCGAGCATAGTTCTGACTAGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-1232s21c1
Sequence:CCGGGATCCTGGCCTCACCTATATACTCGAGTATATAGGTGAGGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-711s21c1
Sequence:CCGGCCAAGCCACTGGGTTCATGTTCTCGAGAACATGAACCCAGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026383.2-510s21c1
Sequence:CCGGGAACGAGGACATGGGTACAATCTCGAGATTGTACCCATGTCCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks