EMAIL THIS PAGE TO A FRIEND

POC1A

POC1 centriolar protein A

Synonyms: PIX2 SOFT WDR51A
Gene ID:
Human(25886) Summary: POC1 proteins contain an N-terminal WD40 domain and a C-terminal coiled coil domain and are part of centrosomes. They play an important role in basal body and cilia formation. This gene encodes one of the two POC1 proteins found in humans. Mutations in this gene result in short stature, onychodysplasia, facial dysmorphism, and hypotrichosis (SOFT) syndrome. [provided by RefSeq, Sep 2012]
Mouse(70235) POC1 centriolar protein homolog A (Chlamydomonas)
Rat(501048) POC1 centriolar protein homolog A (Chlamydomonas)
Zebrafish(406322) POC1 centriolar protein homolog A (Chlamydomonas)
domestic cat(101080436) POC1 centriolar protein homolog A (Chlamydomonas)
dog(484741) POC1 centriolar protein homolog A (Chlamydomonas)
chicken(415889) POC1 centriolar protein homolog A (Chlamydomonas)
cow(534489) POC1 centriolar protein homolog A (Chlamydomonas)
sheep(101113105) POC1 centriolar protein homolog A (Chlamydomonas)
naked mole-rat(101700310) POC1 centriolar protein homolog A (Chlamydomonas)
domestic guinea pig(100714602) POC1 centriolar protein homolog A (Chlamydomonas)
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015426 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027354 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027354 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027354 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015426 Rosetta Predictions human pricing
NM_001109296 Rosetta Predictions rat pricing
NM_027354 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074543 predicted 271
2 SASI_Hs01_00074544 predicted 718
3 SASI_Hs01_00074545 predicted 1220
4 SASI_Hs01_00074546 predicted 409
5 SASI_Hs01_00074547 predicted 554
6 SASI_Hs01_00074548 predicted 226
7 SASI_Hs02_00347811 predicted 1340
8 SASI_Hs01_00074549 predicted 926
9 SASI_Hs01_00074550 predicted 553
10 SASI_Hs01_00074552 predicted 1303
11 SASI_Hs01_00074551 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247024 predicted 879
2 SASI_Rn02_00247025 predicted 504
3 SASI_Rn02_00247026 predicted 331
4 SASI_Rn02_00247027 predicted 875
5 SASI_Rn02_00247028 predicted 405
6 SASI_Rn02_00247029 predicted 1094
7 SASI_Rn02_00247030 predicted 792
8 SASI_Rn02_00247031 predicted 342
9 SASI_Rn02_00247032 predicted 481
10 SASI_Rn02_00247033 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192981 predicted 696
2 SASI_Mm01_00192982 predicted 928
3 SASI_Mm01_00192983 predicted 562
4 SASI_Mm01_00192984 predicted 985
5 SASI_Mm01_00192985 predicted 901
6 SASI_Mm01_00192986 predicted 464
7 SASI_Mm01_00192987 predicted 688
8 SASI_Mm01_00192988 predicted 536
9 SASI_Mm01_00192989 predicted 551
10 SASI_Mm01_00192990 predicted 848
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015426
VALIDATED
POC1A MISSION shRNA Bacterial Glycerol Stock
POC1 centriolar protein A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015426.3-521s21c1
Sequence:CCGGCAGTGATGACAAGACTGTTAACTCGAGTTAACAGTCTTGTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015426.3-226s21c1
Sequence:CCGGCCTGTGTGAACTTCTCTCCTTCTCGAGAAGGAGAGAAGTTCACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015426.3-1650s21c1
Sequence:CCGGGCCATGGTGTAGAAATTGATTCTCGAGAATCAATTTCTACACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015426.3-948s21c1
Sequence:CCGGGATCATGGAGAAGTCACGAAACTCGAGTTTCGTGACTTCTCCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-1651s1c1
Sequence:CCGGGCCATGGTGTAGAAATTGATTCTCGAGAATCAATTTCTACACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-397s1c1
Sequence:CCGGTCTGACGACAAGACAGTCAAACTCGAGTTTGACTGTCTTGTCGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-227s1c1
Sequence:CCGGCCTGTGTGAACTTCTCTCCTTCTCGAGAAGGAGAGAAGTTCACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-949s1c1
Sequence:CCGGGATCATGGAGAAGTCACGAAACTCGAGTTTCGTGACTTCTCCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-522s1c1
Sequence:CCGGCAGTGATGACAAGACTGTTAACTCGAGTTAACAGTCTTGTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015426
VALIDATED
POC1A MISSION shRNA shRNA Plasmid DNA
POC1 centriolar protein A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015426.3-521s21c1
Sequence:CCGGCAGTGATGACAAGACTGTTAACTCGAGTTAACAGTCTTGTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015426.3-226s21c1
Sequence:CCGGCCTGTGTGAACTTCTCTCCTTCTCGAGAAGGAGAGAAGTTCACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015426.3-1650s21c1
Sequence:CCGGGCCATGGTGTAGAAATTGATTCTCGAGAATCAATTTCTACACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015426.3-948s21c1
Sequence:CCGGGATCATGGAGAAGTCACGAAACTCGAGTTTCGTGACTTCTCCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-1651s1c1
Sequence:CCGGGCCATGGTGTAGAAATTGATTCTCGAGAATCAATTTCTACACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-397s1c1
Sequence:CCGGTCTGACGACAAGACAGTCAAACTCGAGTTTGACTGTCTTGTCGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-227s1c1
Sequence:CCGGCCTGTGTGAACTTCTCTCCTTCTCGAGAAGGAGAGAAGTTCACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-949s1c1
Sequence:CCGGGATCATGGAGAAGTCACGAAACTCGAGTTTCGTGACTTCTCCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-522s1c1
Sequence:CCGGCAGTGATGACAAGACTGTTAACTCGAGTTAACAGTCTTGTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015426
VALIDATED
POC1A MISSION shRNA Lentiviral Transduction Particles
POC1 centriolar protein A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015426.3-521s21c1
Sequence:CCGGCAGTGATGACAAGACTGTTAACTCGAGTTAACAGTCTTGTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015426.3-226s21c1
Sequence:CCGGCCTGTGTGAACTTCTCTCCTTCTCGAGAAGGAGAGAAGTTCACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015426.3-1650s21c1
Sequence:CCGGGCCATGGTGTAGAAATTGATTCTCGAGAATCAATTTCTACACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015426.3-948s21c1
Sequence:CCGGGATCATGGAGAAGTCACGAAACTCGAGTTTCGTGACTTCTCCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-1651s1c1
Sequence:CCGGGCCATGGTGTAGAAATTGATTCTCGAGAATCAATTTCTACACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-397s1c1
Sequence:CCGGTCTGACGACAAGACAGTCAAACTCGAGTTTGACTGTCTTGTCGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-227s1c1
Sequence:CCGGCCTGTGTGAACTTCTCTCCTTCTCGAGAAGGAGAGAAGTTCACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-949s1c1
Sequence:CCGGGATCATGGAGAAGTCACGAAACTCGAGTTTCGTGACTTCTCCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015426.2-522s1c1
Sequence:CCGGCAGTGATGACAAGACTGTTAACTCGAGTTAACAGTCTTGTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027354
POC1A MISSION shRNA Bacterial Glycerol Stock
POC1 centriolar protein A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027354.1-306s1c1
Sequence:CCGGCCCAATGTCAAAGGTGAGTCACTCGAGTGACTCACCTTTGACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027354.1-1214s1c1
Sequence:CCGGCCTGGAGAACCAGCAGTTAATCTCGAGATTAACTGCTGGTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027354.1-566s1c1
Sequence:CCGGCCGGGAATGTATCCACTCATACTCGAGTATGAGTGGATACATTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027354.1-314s1c1
Sequence:CCGGCAAAGGTGAGTCAACTGTATTCTCGAGAATACAGTTGACTCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027354
POC1A MISSION shRNA shRNA Plasmid DNA
POC1 centriolar protein A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027354.1-306s1c1
Sequence:CCGGCCCAATGTCAAAGGTGAGTCACTCGAGTGACTCACCTTTGACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027354.1-1214s1c1
Sequence:CCGGCCTGGAGAACCAGCAGTTAATCTCGAGATTAACTGCTGGTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027354.1-566s1c1
Sequence:CCGGCCGGGAATGTATCCACTCATACTCGAGTATGAGTGGATACATTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027354.1-314s1c1
Sequence:CCGGCAAAGGTGAGTCAACTGTATTCTCGAGAATACAGTTGACTCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027354
POC1A MISSION shRNA Lentiviral Transduction Particles
POC1 centriolar protein A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027354.1-306s1c1
Sequence:CCGGCCCAATGTCAAAGGTGAGTCACTCGAGTGACTCACCTTTGACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027354.1-1214s1c1
Sequence:CCGGCCTGGAGAACCAGCAGTTAATCTCGAGATTAACTGCTGGTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027354.1-566s1c1
Sequence:CCGGCCGGGAATGTATCCACTCATACTCGAGTATGAGTGGATACATTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027354.1-314s1c1
Sequence:CCGGCAAAGGTGAGTCAACTGTATTCTCGAGAATACAGTTGACTCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks