EMAIL THIS PAGE TO A FRIEND

PODXL

podocalyxin-like

Synonyms: Gp200 PC PCLP PCLP-1
UniProtKB ID: O00592, A6NHX8, Q52LZ7, Q53ER6
Gene ID:
Human(5420) Summary: This gene encodes a member of the sialomucin protein family. The encoded protein was originally identified as an important component of glomerular podocytes. Podocytes are highly differentiated epithelial cells with interdigitating foot processes covering the outer aspect of the glomerular basement membrane. Other biological activities of the encoded protein include: binding in a membrane protein complex with Na+/H+ exchanger regulatory factor to intracellular cytoskeletal elements, playing a role in hematopoetic cell differentiation, and being expressed in vascular endothelium cells and binding to L-selectin. [provided by RefSeq, Jul 2008]
Mouse(27205) podocalyxin-like
Rat(192181) podocalyxin-like
Zebrafish(563365) podocalyxin-like
dog(482252) podocalyxin-like
domestic cat(101094167) podocalyxin-like
chicken(395755) podocalyxin-like
naked mole-rat(101723514) podocalyxin-like
cow(616366) podocalyxin-like
sheep(101106679) podocalyxin-like
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44730 Anti-PODXL (AB1) antibody produced in rabbit affinity isolated antibody, lyophilized powder human
western blot pricing
AV44729 Anti-PODXL (AB2) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder human
western blot pricing
SAB2500809 Anti-PODXL antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, rat, human, mouse
ELISA, western blot pricing
SAB2108029 Anti-PODXL antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2108030 Anti-PODXL antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
HPA002110 Anti-PODXL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA045507 Anti-PODXL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AMAB90644 Monoclonal Anti-PODXL antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0285, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90643 Monoclonal Anti-PODXL antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0284, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90667 Monoclonal Anti-PODXL antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0308, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5300033 Monoclonal Anti-PODXL antibody produced in mouse clone 5D4, ascites fluid human
ELISA, western blot pricing
SAB5300034 Monoclonal Anti-PODXL antibody produced in mouse clone 5F5, ascites fluid human
ELISA, flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005397 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013723 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013723 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013723 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019851 MISSION® esiRNA esiRNA human PODXL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018111 Rosetta Predictions human pricing
NM_005397 Rosetta Predictions human pricing
NM_138848 Rosetta Predictions rat pricing
NM_013723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145973 predicted 1536
2 SASI_Hs01_00145974 predicted 1281
3 SASI_Hs01_00145975 predicted 1385
4 SASI_Hs01_00145976 predicted 1859
5 SASI_Hs01_00145978 predicted 1324
6 SASI_Hs01_00145979 predicted 640
7 SASI_Hs01_00145980 predicted 1363
8 SASI_Hs02_00307028 predicted 1453
9 SASI_Hs01_00145981 predicted 1311
10 SASI_Hs01_00145982 predicted 1648
11 SASI_Hs01_00145977 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163776 predicted 1441
2 SASI_Hs01_00163777 predicted 1181
3 SASI_Hs01_00163778 predicted 1294
4 SASI_Hs01_00163779 predicted 1765
5 SASI_Hs01_00163781 predicted 1233
6 SASI_Hs01_00163782 predicted 641
7 SASI_Hs01_00163783 predicted 1266
8 SASI_Hs02_00339524 predicted 1355
9 SASI_Hs01_00163784 predicted 1216
10 SASI_Hs01_00163785 predicted 1553
11 SASI_Hs01_00163780 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084238 predicted 379
2 SASI_Rn01_00084239 predicted 1153
3 SASI_Rn01_00084241 predicted 1571
4 SASI_Rn01_00084242 predicted 283
5 SASI_Rn01_00084243 predicted 219
6 SASI_Rn01_00084244 predicted 877
7 SASI_Rn01_00084245 predicted 1144
8 SASI_Rn01_00084246 predicted 1479
9 SASI_Rn01_00084247 predicted 256
10 SASI_Rn02_00268237 predicted 236
11 SASI_Rn01_00084240 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040552 predicted 402
2 SASI_Mm01_00040553 predicted 360
3 SASI_Mm01_00040555 predicted 936
4 SASI_Mm01_00040556 predicted 906
5 SASI_Mm02_00322640 predicted 742
6 SASI_Mm01_00040558 predicted 1281
7 SASI_Mm01_00040559 predicted 1348
8 SASI_Mm01_00040560 predicted 1688
9 SASI_Mm01_00040561 predicted 714
10 SASI_Mm02_00322641 predicted 1196
11 SASI_Mm01_00040554 predicted 1328
12 SASI_Mm01_00040557 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005397
VALIDATED
PODXL MISSION shRNA Bacterial Glycerol Stock
podocalyxin-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005397.3-1436s21c1
Sequence:CCGGACGAGCGGCTGAAGGACAAATCTCGAGATTTGTCCTTCAGCCGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005397.3-460s21c1
Sequence:CCGGACTTCCAAGGCCAACGAAATCCTCGAGGATTTCGTTGGCCTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005397.3-1387s21c1
Sequence:CCGGGTCGTCAAAGAAATCACTATTCTCGAGAATAGTGATTTCTTTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005397.3-867s21c1
Sequence:CCGGCTCGGGACATGACCATCTTATCTCGAGATAAGATGGTCATGTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005397.3-2091s21c1
Sequence:CCGGAGCCACGTAAGGGACTTTATACTCGAGTATAAAGTCCCTTACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005397.2-4352s1c1
Sequence:CCGGCCACCTTTACTGGGTTCTAAACTCGAGTTTAGAACCCAGTAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005397.2-957s1c1
Sequence:CCGGCGTCATCGGTTATCTCGCAAACTCGAGTTTGCGAGATAACCGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005397.2-1274s1c1
Sequence:CCGGGAGAAATTGATCTCACTGATACTCGAGTATCAGTGAGATCAATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005397.2-1379s1c1
Sequence:CCGGGTCGTCAAAGAAATCACTATTCTCGAGAATAGTGATTTCTTTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005397.2-960s1c1
Sequence:CCGGCATCGGTTATCTCGCAAAGAACTCGAGTTCTTTGCGAGATAACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005397
VALIDATED
PODXL MISSION shRNA shRNA Plasmid DNA
podocalyxin-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005397.3-1436s21c1
Sequence:CCGGACGAGCGGCTGAAGGACAAATCTCGAGATTTGTCCTTCAGCCGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005397.3-460s21c1
Sequence:CCGGACTTCCAAGGCCAACGAAATCCTCGAGGATTTCGTTGGCCTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005397.3-1387s21c1
Sequence:CCGGGTCGTCAAAGAAATCACTATTCTCGAGAATAGTGATTTCTTTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005397.3-867s21c1
Sequence:CCGGCTCGGGACATGACCATCTTATCTCGAGATAAGATGGTCATGTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005397.3-2091s21c1
Sequence:CCGGAGCCACGTAAGGGACTTTATACTCGAGTATAAAGTCCCTTACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005397.2-4352s1c1
Sequence:CCGGCCACCTTTACTGGGTTCTAAACTCGAGTTTAGAACCCAGTAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005397.2-957s1c1
Sequence:CCGGCGTCATCGGTTATCTCGCAAACTCGAGTTTGCGAGATAACCGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005397.2-1274s1c1
Sequence:CCGGGAGAAATTGATCTCACTGATACTCGAGTATCAGTGAGATCAATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005397.2-1379s1c1
Sequence:CCGGGTCGTCAAAGAAATCACTATTCTCGAGAATAGTGATTTCTTTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005397.2-960s1c1
Sequence:CCGGCATCGGTTATCTCGCAAAGAACTCGAGTTCTTTGCGAGATAACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005397
VALIDATED
PODXL MISSION shRNA Lentiviral Transduction Particles
podocalyxin-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005397.3-1436s21c1
Sequence:CCGGACGAGCGGCTGAAGGACAAATCTCGAGATTTGTCCTTCAGCCGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005397.3-460s21c1
Sequence:CCGGACTTCCAAGGCCAACGAAATCCTCGAGGATTTCGTTGGCCTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005397.3-1387s21c1
Sequence:CCGGGTCGTCAAAGAAATCACTATTCTCGAGAATAGTGATTTCTTTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005397.3-867s21c1
Sequence:CCGGCTCGGGACATGACCATCTTATCTCGAGATAAGATGGTCATGTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005397.3-2091s21c1
Sequence:CCGGAGCCACGTAAGGGACTTTATACTCGAGTATAAAGTCCCTTACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005397.2-4352s1c1
Sequence:CCGGCCACCTTTACTGGGTTCTAAACTCGAGTTTAGAACCCAGTAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005397.2-957s1c1
Sequence:CCGGCGTCATCGGTTATCTCGCAAACTCGAGTTTGCGAGATAACCGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005397.2-1274s1c1
Sequence:CCGGGAGAAATTGATCTCACTGATACTCGAGTATCAGTGAGATCAATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005397.2-1379s1c1
Sequence:CCGGGTCGTCAAAGAAATCACTATTCTCGAGAATAGTGATTTCTTTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005397.2-960s1c1
Sequence:CCGGCATCGGTTATCTCGCAAAGAACTCGAGTTCTTTGCGAGATAACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013723
VALIDATED
PODXL MISSION shRNA Bacterial Glycerol Stock
podocalyxin-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013723.3-1172s21c1
Sequence:CCGGCCAGATGAGGAACTCCTTATTCTCGAGAATAAGGAGTTCCTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013723.3-1944s21c1
Sequence:CCGGCAATCCCTACAGGGCCTTAATCTCGAGATTAAGGCCCTGTAGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013723.3-338s21c1
Sequence:CCGGCCTGCATCTCACTCCCATAATCTCGAGATTATGGGAGTGAGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013723.3-1380s21c1
Sequence:CCGGTTTCTCCTAAGGCCGTGTATGCTCGAGCATACACGGCCTTAGGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013723.3-732s21c1
Sequence:CCGGCTCAGCCTACTGACCTTAATACTCGAGTATTAAGGTCAGTAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013723.2-4008s1c1
Sequence:CCGGGCTCTTCATTTCAGTGGCAAACTCGAGTTTGCCACTGAAATGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013723.2-1105s1c1
Sequence:CCGGCCTTTGGAAATTACCAGCTAACTCGAGTTAGCTGGTAATTTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013723.2-312s1c1
Sequence:CCGGCCTGCATCTCACTCCCATAATCTCGAGATTATGGGAGTGAGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013723.2-1106s1c1
Sequence:CCGGCTTTGGAAATTACCAGCTAAACTCGAGTTTAGCTGGTAATTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013723.2-457s1c1
Sequence:CCGGGCAACCCTACACCATTCACAACTCGAGTTGTGAATGGTGTAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013723
VALIDATED
PODXL MISSION shRNA shRNA Plasmid DNA
podocalyxin-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013723.3-1172s21c1
Sequence:CCGGCCAGATGAGGAACTCCTTATTCTCGAGAATAAGGAGTTCCTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013723.3-1944s21c1
Sequence:CCGGCAATCCCTACAGGGCCTTAATCTCGAGATTAAGGCCCTGTAGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013723.3-338s21c1
Sequence:CCGGCCTGCATCTCACTCCCATAATCTCGAGATTATGGGAGTGAGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013723.3-1380s21c1
Sequence:CCGGTTTCTCCTAAGGCCGTGTATGCTCGAGCATACACGGCCTTAGGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013723.3-732s21c1
Sequence:CCGGCTCAGCCTACTGACCTTAATACTCGAGTATTAAGGTCAGTAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013723.2-4008s1c1
Sequence:CCGGGCTCTTCATTTCAGTGGCAAACTCGAGTTTGCCACTGAAATGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013723.2-1105s1c1
Sequence:CCGGCCTTTGGAAATTACCAGCTAACTCGAGTTAGCTGGTAATTTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013723.2-312s1c1
Sequence:CCGGCCTGCATCTCACTCCCATAATCTCGAGATTATGGGAGTGAGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013723.2-1106s1c1
Sequence:CCGGCTTTGGAAATTACCAGCTAAACTCGAGTTTAGCTGGTAATTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013723.2-457s1c1
Sequence:CCGGGCAACCCTACACCATTCACAACTCGAGTTGTGAATGGTGTAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013723
VALIDATED
PODXL MISSION shRNA Lentiviral Transduction Particles
podocalyxin-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013723.3-1172s21c1
Sequence:CCGGCCAGATGAGGAACTCCTTATTCTCGAGAATAAGGAGTTCCTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013723.3-1944s21c1
Sequence:CCGGCAATCCCTACAGGGCCTTAATCTCGAGATTAAGGCCCTGTAGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013723.3-338s21c1
Sequence:CCGGCCTGCATCTCACTCCCATAATCTCGAGATTATGGGAGTGAGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013723.3-1380s21c1
Sequence:CCGGTTTCTCCTAAGGCCGTGTATGCTCGAGCATACACGGCCTTAGGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013723.3-732s21c1
Sequence:CCGGCTCAGCCTACTGACCTTAATACTCGAGTATTAAGGTCAGTAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013723.2-4008s1c1
Sequence:CCGGGCTCTTCATTTCAGTGGCAAACTCGAGTTTGCCACTGAAATGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013723.2-1105s1c1
Sequence:CCGGCCTTTGGAAATTACCAGCTAACTCGAGTTAGCTGGTAATTTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013723.2-312s1c1
Sequence:CCGGCCTGCATCTCACTCCCATAATCTCGAGATTATGGGAGTGAGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013723.2-1106s1c1
Sequence:CCGGCTTTGGAAATTACCAGCTAAACTCGAGTTTAGCTGGTAATTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013723.2-457s1c1
Sequence:CCGGGCAACCCTACACCATTCACAACTCGAGTTGTGAATGGTGTAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks