EMAIL THIS PAGE TO A FRIEND

POFUT1

protein O-fucosyltransferase 1

Synonyms: DDD2 FUT12 O-FUT O-Fuc-T O-FucT-1 OFUCT1
UniProtKB ID: Q9H488, A8K4R8, E1P5M4, Q14685, Q5W185, Q9BW76
Gene ID:
Human(23509) Summary: This gene encodes a member of the glycosyltransferase O-Fuc family. This enzyme adds O-fucose through an O-glycosidic linkage to conserved serine or threonine residues in the epidermal growth factor-like repeats of a number of cell surface and secreted proteins. O-fucose glycans are involved in ligand-induced receptor signaling. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(140484) protein O-fucosyltransferase 1
Rat(311551) protein O-fucosyltransferase 1
cow(360194) protein O-fucosyltransferase 1
sheep(101104000) protein O-fucosyltransferase 1
naked mole-rat(101707778) protein O-fucosyltransferase 1
domestic guinea pig(100733160) protein O-fucosyltransferase 1
Zebrafish(403029) protein O-fucosyltransferase 1
domestic cat(101094335) protein O-fucosyltransferase 1
dog(609881) protein O-fucosyltransferase 1
chicken(395070) protein O-fucosyltransferase 1
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015352 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091561 MISSION® esiRNA esiRNA human POFUT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015352 Rosetta Predictions human pricing
NM_172236 Rosetta Predictions human pricing
NM_001002278 Rosetta Predictions rat pricing
XM_579072 Rosetta Predictions rat pricing
NM_001039055 Rosetta Predictions mouse pricing
NM_080463 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168710 predicted 292
2 SASI_Hs01_00168711 predicted 297
3 SASI_Hs01_00168712 predicted 334
4 SASI_Hs01_00168713 predicted 336
5 SASI_Hs01_00168714 predicted 267
6 SASI_Hs01_00168715 predicted 205
7 SASI_Hs01_00168716 predicted 203
8 SASI_Hs01_00168717 predicted 286
9 SASI_Hs01_00168718 predicted 246
10 SASI_Hs01_00168719 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130606 predicted 286
2 SASI_Hs01_00130607 predicted 296
3 SASI_Hs01_00130608 predicted 330
4 SASI_Hs01_00130609 predicted 336
5 SASI_Hs01_00130610 predicted 268
6 SASI_Hs01_00130611 predicted 206
7 SASI_Hs01_00130612 predicted 201
8 SASI_Hs01_00130613 predicted 288
9 SASI_Hs01_00130614 predicted 242
10 SASI_Hs01_00130615 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058368 predicted 224
2 SASI_Rn01_00058369 predicted 927
3 SASI_Rn01_00058370 predicted 505
4 SASI_Rn01_00058371 predicted 729
5 SASI_Rn01_00058372 predicted 480
6 SASI_Rn01_00058373 predicted 746
7 SASI_Rn01_00058374 predicted 732
8 SASI_Rn01_00058375 predicted 644
9 SASI_Rn01_00058376 predicted 391
10 SASI_Rn01_00058377 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136114 predicted 228
2 SASI_Rn01_00136115 predicted 221
3 SASI_Rn01_00136116 predicted 418
4 SASI_Rn01_00136117 predicted 392
5 SASI_Rn01_00136118 predicted 268
6 SASI_Rn01_00136119 predicted 379
7 SASI_Rn01_00136120 predicted 416
8 SASI_Rn01_00136121 predicted 214
9 SASI_Rn01_00136122 predicted 231
10 SASI_Rn01_00136123 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189414 predicted 3116
2 SASI_Mm01_00189415 predicted 3184
3 SASI_Mm01_00189416 predicted 2089
4 SASI_Mm01_00189417 predicted 2918
5 SASI_Mm01_00189418 predicted 1959
6 SASI_Mm01_00189419 predicted 3218
7 SASI_Mm01_00189420 predicted 2102
8 SASI_Mm01_00189421 predicted 3112
9 SASI_Mm01_00189422 predicted 2270
10 SASI_Mm02_00289745 predicted 2428
11 SASI_Mm01_00189423 predicted 2202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080463 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191252 predicted 422
2 SASI_Mm01_00191253 predicted 276
3 SASI_Mm01_00191254 predicted 527
4 SASI_Mm01_00191255 predicted 441
5 SASI_Mm01_00191256 predicted 92
6 SASI_Mm01_00191257 predicted 552
7 SASI_Mm01_00191258 predicted 758
8 SASI_Mm01_00191259 predicted 695
9 SASI_Mm01_00191260 predicted 934
10 SASI_Mm01_00191261 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015352
VALIDATED
POFUT1 MISSION shRNA Bacterial Glycerol Stock
protein O-fucosyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015352.1-963s1c1
Sequence:CCGGCGGTCTACGTTGCTACTGATTCTCGAGAATCAGTAGCAACGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015352.1-743s1c1
Sequence:CCGGCGGCCCTATGTGGGCATTCATCTCGAGATGAATGCCCACATAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_015352.1-974s1c1
Sequence:CCGGGCTACTGATTCCGAGAGTTATCTCGAGATAACTCTCGGAATCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015352.1-511s1c1
Sequence:CCGGGTTTCATGTGAGTTTCAACAACTCGAGTTGTTGAAACTCACATGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015352.1-298s1c1
Sequence:CCGGCCATGTGTCCTACCAGAAGTACTCGAGTACTTCTGGTAGGACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-201s21c1
Sequence:CCGGTCTTGGGCTCTCTGGCATTTGCTCGAGCAAATGCCAGAGAGCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-352s21c1
Sequence:CCGGGGTCATCAGCTTGGAGGATTTCTCGAGAAATCCTCCAAGCTGATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-683s21c1
Sequence:CCGGATGGTATGGTCAGACGAAATGCTCGAGCATTTCGTCTGACCATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-511s21c1
Sequence:CCGGGTTTCATGTGAGTTTCAACAACTCGAGTTGTTGAAACTCACATGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-1082s21c1
Sequence:CCGGGGCCAAGCCGACCACTTTATTCTCGAGAATAAAGTGGTCGGCTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015352
VALIDATED
POFUT1 MISSION shRNA shRNA Plasmid DNA
protein O-fucosyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015352.1-963s1c1
Sequence:CCGGCGGTCTACGTTGCTACTGATTCTCGAGAATCAGTAGCAACGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015352.1-743s1c1
Sequence:CCGGCGGCCCTATGTGGGCATTCATCTCGAGATGAATGCCCACATAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_015352.1-974s1c1
Sequence:CCGGGCTACTGATTCCGAGAGTTATCTCGAGATAACTCTCGGAATCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015352.1-511s1c1
Sequence:CCGGGTTTCATGTGAGTTTCAACAACTCGAGTTGTTGAAACTCACATGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015352.1-298s1c1
Sequence:CCGGCCATGTGTCCTACCAGAAGTACTCGAGTACTTCTGGTAGGACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-201s21c1
Sequence:CCGGTCTTGGGCTCTCTGGCATTTGCTCGAGCAAATGCCAGAGAGCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-352s21c1
Sequence:CCGGGGTCATCAGCTTGGAGGATTTCTCGAGAAATCCTCCAAGCTGATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-683s21c1
Sequence:CCGGATGGTATGGTCAGACGAAATGCTCGAGCATTTCGTCTGACCATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-511s21c1
Sequence:CCGGGTTTCATGTGAGTTTCAACAACTCGAGTTGTTGAAACTCACATGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-1082s21c1
Sequence:CCGGGGCCAAGCCGACCACTTTATTCTCGAGAATAAAGTGGTCGGCTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015352
VALIDATED
POFUT1 MISSION shRNA Lentiviral Transduction Particles
protein O-fucosyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015352.1-963s1c1
Sequence:CCGGCGGTCTACGTTGCTACTGATTCTCGAGAATCAGTAGCAACGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015352.1-743s1c1
Sequence:CCGGCGGCCCTATGTGGGCATTCATCTCGAGATGAATGCCCACATAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_015352.1-974s1c1
Sequence:CCGGGCTACTGATTCCGAGAGTTATCTCGAGATAACTCTCGGAATCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015352.1-511s1c1
Sequence:CCGGGTTTCATGTGAGTTTCAACAACTCGAGTTGTTGAAACTCACATGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015352.1-298s1c1
Sequence:CCGGCCATGTGTCCTACCAGAAGTACTCGAGTACTTCTGGTAGGACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-201s21c1
Sequence:CCGGTCTTGGGCTCTCTGGCATTTGCTCGAGCAAATGCCAGAGAGCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-352s21c1
Sequence:CCGGGGTCATCAGCTTGGAGGATTTCTCGAGAAATCCTCCAAGCTGATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-683s21c1
Sequence:CCGGATGGTATGGTCAGACGAAATGCTCGAGCATTTCGTCTGACCATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-511s21c1
Sequence:CCGGGTTTCATGTGAGTTTCAACAACTCGAGTTGTTGAAACTCACATGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015352.1-1082s21c1
Sequence:CCGGGGCCAAGCCGACCACTTTATTCTCGAGAATAAAGTGGTCGGCTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039055
VALIDATED
POFUT1 MISSION shRNA Bacterial Glycerol Stock
protein O-fucosyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039055.1-3315s21c1
Sequence:CCGGAGCCTAAAGTGACCTTATAAACTCGAGTTTATAAGGTCACTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039055.1-1980s21c1
Sequence:CCGGTTTCGTCTCTTGCTTGTTATACTCGAGTATAACAAGCAAGAGACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039055.1-1876s21c1
Sequence:CCGGACAAGCAAAGAAGGTTGTAAACTCGAGTTTACAACCTTCTTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039055.1-2029s21c1
Sequence:CCGGTGGTGCAATGCCATCCTTTATCTCGAGATAAAGGATGGCATTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039055.1-1952s21c1
Sequence:CCGGCTTATCAGCCAGTTGAGATTTCTCGAGAAATCTCAACTGGCTGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039055
VALIDATED
POFUT1 MISSION shRNA shRNA Plasmid DNA
protein O-fucosyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039055.1-3315s21c1
Sequence:CCGGAGCCTAAAGTGACCTTATAAACTCGAGTTTATAAGGTCACTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039055.1-1980s21c1
Sequence:CCGGTTTCGTCTCTTGCTTGTTATACTCGAGTATAACAAGCAAGAGACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039055.1-1876s21c1
Sequence:CCGGACAAGCAAAGAAGGTTGTAAACTCGAGTTTACAACCTTCTTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039055.1-2029s21c1
Sequence:CCGGTGGTGCAATGCCATCCTTTATCTCGAGATAAAGGATGGCATTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039055.1-1952s21c1
Sequence:CCGGCTTATCAGCCAGTTGAGATTTCTCGAGAAATCTCAACTGGCTGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039055
VALIDATED
POFUT1 MISSION shRNA Lentiviral Transduction Particles
protein O-fucosyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039055.1-3315s21c1
Sequence:CCGGAGCCTAAAGTGACCTTATAAACTCGAGTTTATAAGGTCACTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039055.1-1980s21c1
Sequence:CCGGTTTCGTCTCTTGCTTGTTATACTCGAGTATAACAAGCAAGAGACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039055.1-1876s21c1
Sequence:CCGGACAAGCAAAGAAGGTTGTAAACTCGAGTTTACAACCTTCTTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039055.1-2029s21c1
Sequence:CCGGTGGTGCAATGCCATCCTTTATCTCGAGATAAAGGATGGCATTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039055.1-1952s21c1
Sequence:CCGGCTTATCAGCCAGTTGAGATTTCTCGAGAAATCTCAACTGGCTGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks