EMAIL THIS PAGE TO A FRIEND

POFUT2

protein O-fucosyltransferase 2

Synonyms: C21orf80 FUT13
Gene ID:
Human(23275) Summary: Fucose is typically found as a terminal modification of branched chain glycoconjugates, but it also exists in direct O-linkage to serine or threonine residues within cystine knot motifs in epidermal growth factor (EGF; MIM 131530)-like repeats or thrombospondin (THBS; see MIM 188060) type-1 repeats. POFUT2 is an O-fucosyltransferase that use THBS type-1 repeats as substrates (Luo et al., 2006 [PubMed 16464857]
Mouse(80294) protein O-fucosyltransferase 2
Rat(309686) protein O-fucosyltransferase 2
Zebrafish(777668) protein O-fucosyltransferase 2
chicken(395112) protein O-fucosyltransferase 2
domestic cat(101086742) protein O-fucosyltransferase 2
domestic guinea pig(100728767) protein O-fucosyltransferase 2
naked mole-rat(101705482) protein O-fucosyltransferase 2
cow(404083) protein O-fucosyltransferase 2
sheep(101105718) protein O-fucosyltransferase 2
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015227 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU062161 MISSION® esiRNA esiRNA targeting mouse Pofut2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015227 Rosetta Predictions human pricing
NM_133634 Rosetta Predictions human pricing
NM_133635 Rosetta Predictions human pricing
NR_004858 Rosetta Predictions human pricing
NM_001107621 Rosetta Predictions rat pricing
NM_030262 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028692 predicted 398
2 SASI_Hs01_00028693 predicted 680
3 SASI_Hs01_00028694 predicted 210
4 SASI_Hs01_00028696 predicted 409
5 SASI_Hs01_00028698 predicted 497
6 SASI_Hs01_00028699 predicted 418
7 SASI_Hs01_00028701 predicted 426
8 SASI_Hs02_00347337 predicted 930
9 SASI_Hs02_00347338 predicted 411
10 SASI_Hs02_00347339 predicted 531
11 SASI_Hs01_00028695 predicted 326
12 SASI_Hs01_00028697 predicted 724
13 SASI_Hs01_00028700 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147632 predicted 402
2 SASI_Hs01_00147633 predicted 684
3 SASI_Hs01_00147634 predicted 218
4 SASI_Hs01_00147635 predicted 322
5 SASI_Hs01_00147636 predicted 419
6 SASI_Hs01_00147637 predicted 708
7 SASI_Hs01_00147638 predicted 727
8 SASI_Hs01_00147639 predicted 502
9 SASI_Hs01_00147640 predicted 430
10 SASI_Hs01_00147641 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011538 predicted 406
2 SASI_Hs01_00011539 predicted 675
3 SASI_Hs01_00011540 predicted 217
4 SASI_Hs01_00011542 predicted 411
5 SASI_Hs01_00011545 predicted 1596
6 SASI_Hs01_00011546 predicted 506
7 SASI_Hs01_00011547 predicted 423
8 SASI_Hs02_00363266 predicted 1747
9 SASI_Hs02_00363267 predicted 926
10 SASI_Hs02_00363268 predicted 525
11 SASI_Hs01_00011541 predicted 323
12 SASI_Hs01_00011543 predicted 1641
13 SASI_Hs01_00011544 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_004858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381022 predicted 405
2 SASI_Hs02_00381023 predicted 1126
3 SASI_Hs02_00381024 predicted 503
4 SASI_Hs02_00381025 predicted 415
5 SASI_Hs02_00381026 predicted 423
6 SASI_Hs02_00381027 predicted 411
7 SASI_Hs02_00381028 predicted 576
8 SASI_Hs02_00381029 predicted 537
9 SASI_Hs02_00381030 predicted 687
10 SASI_Hs02_00381031 predicted 2771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230635 predicted 849
2 SASI_Rn02_00230636 predicted 225
3 SASI_Rn02_00230637 predicted 1846
4 SASI_Rn02_00230638 predicted 1510
5 SASI_Rn02_00230639 predicted 582
6 SASI_Rn02_00230640 predicted 415
7 SASI_Rn02_00230641 predicted 453
8 SASI_Rn02_00230642 predicted 1760
9 SASI_Rn02_00230643 predicted 452
10 SASI_Rn02_00230644 predicted 1756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087742 predicted 1513
2 SASI_Mm01_00087743 predicted 504
3 SASI_Mm01_00087744 predicted 219
4 SASI_Mm01_00087745 predicted 1319
5 SASI_Mm01_00087747 predicted 246
6 SASI_Mm01_00087748 predicted 675
7 SASI_Mm01_00087749 predicted 540
8 SASI_Mm02_00336744 predicted 371
9 SASI_Mm01_00087750 predicted 843
10 SASI_Mm01_00087751 predicted 1071
11 SASI_Mm01_00087746 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015227
VALIDATED
POFUT2 MISSION shRNA Bacterial Glycerol Stock
protein O-fucosyltransferase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-407s21c1
Sequence:CCGGGAATCTGGTGGGCCCTTTATTCTCGAGAATAAAGGGCCCACCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-195s21c1
Sequence:CCGGACCTGCGCAGGGATGTCTATACTCGAGTATAGACATCCCTGCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-350s21c1
Sequence:CCGGGATCTTCCAAGTCTCAATAAACTCGAGTTTATTGAGACTTGGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-1116s21c1
Sequence:CCGGACGGAGGCGTTGCGATTATTGCTCGAGCAATAATCGCAACGCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-1255s21c1
Sequence:CCGGCTGTGTTCACAGTGGTCATTTCTCGAGAAATGACCACTGTGAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015227.2-1014s1c1
Sequence:CCGGGCCGTCAGAAAGGAATATGAACTCGAGTTCATATTCCTTTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015227.2-138s1c1
Sequence:CCGGCGCAGACGGTATCTTCTGTATCTCGAGATACAGAAGATACCGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015227.2-407s1c1
Sequence:CCGGGCCCTTTATTGACCAGGTTTACTCGAGTAAACCTGGTCAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015227.2-700s1c1
Sequence:CCGGGAGGGAAAGAATACTGGGATACTCGAGTATCCCAGTATTCTTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015227
VALIDATED
POFUT2 MISSION shRNA shRNA Plasmid DNA
protein O-fucosyltransferase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-407s21c1
Sequence:CCGGGAATCTGGTGGGCCCTTTATTCTCGAGAATAAAGGGCCCACCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-195s21c1
Sequence:CCGGACCTGCGCAGGGATGTCTATACTCGAGTATAGACATCCCTGCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-350s21c1
Sequence:CCGGGATCTTCCAAGTCTCAATAAACTCGAGTTTATTGAGACTTGGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-1116s21c1
Sequence:CCGGACGGAGGCGTTGCGATTATTGCTCGAGCAATAATCGCAACGCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-1255s21c1
Sequence:CCGGCTGTGTTCACAGTGGTCATTTCTCGAGAAATGACCACTGTGAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015227.2-1014s1c1
Sequence:CCGGGCCGTCAGAAAGGAATATGAACTCGAGTTCATATTCCTTTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015227.2-138s1c1
Sequence:CCGGCGCAGACGGTATCTTCTGTATCTCGAGATACAGAAGATACCGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015227.2-407s1c1
Sequence:CCGGGCCCTTTATTGACCAGGTTTACTCGAGTAAACCTGGTCAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015227.2-700s1c1
Sequence:CCGGGAGGGAAAGAATACTGGGATACTCGAGTATCCCAGTATTCTTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015227
VALIDATED
POFUT2 MISSION shRNA Lentiviral Transduction Particles
protein O-fucosyltransferase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-407s21c1
Sequence:CCGGGAATCTGGTGGGCCCTTTATTCTCGAGAATAAAGGGCCCACCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-195s21c1
Sequence:CCGGACCTGCGCAGGGATGTCTATACTCGAGTATAGACATCCCTGCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-350s21c1
Sequence:CCGGGATCTTCCAAGTCTCAATAAACTCGAGTTTATTGAGACTTGGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-1116s21c1
Sequence:CCGGACGGAGGCGTTGCGATTATTGCTCGAGCAATAATCGCAACGCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015227.4-1255s21c1
Sequence:CCGGCTGTGTTCACAGTGGTCATTTCTCGAGAAATGACCACTGTGAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015227.2-1014s1c1
Sequence:CCGGGCCGTCAGAAAGGAATATGAACTCGAGTTCATATTCCTTTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015227.2-138s1c1
Sequence:CCGGCGCAGACGGTATCTTCTGTATCTCGAGATACAGAAGATACCGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015227.2-407s1c1
Sequence:CCGGGCCCTTTATTGACCAGGTTTACTCGAGTAAACCTGGTCAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015227.2-700s1c1
Sequence:CCGGGAGGGAAAGAATACTGGGATACTCGAGTATCCCAGTATTCTTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030262
VALIDATED
POFUT2 MISSION shRNA Bacterial Glycerol Stock
protein O-fucosyltransferase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030262.3-377s21c1
Sequence:CCGGCGTTATAGAGTATGAGCAGTTCTCGAGAACTGCTCATACTCTATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030262.3-238s21c1
Sequence:CCGGCGCTGTTGAAGACTGAAGAGTCTCGAGACTCTTCAGTCTTCAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030262.3-540s21c1
Sequence:CCGGGAGTATTACAGAGGCTGGTTTCTCGAGAAACCAGCCTCTGTAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030262.3-526s21c1
Sequence:CCGGCGCAGGACAAGCATGAGTATTCTCGAGAATACTCATGCTTGTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030262.2-366s1c1
Sequence:CCGGCCGTTATAGAGTATGAGCAGTCTCGAGACTGCTCATACTCTATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030262.2-367s1c1
Sequence:CCGGCGTTATAGAGTATGAGCAGTTCTCGAGAACTGCTCATACTCTATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030262.2-516s1c1
Sequence:CCGGCGCAGGACAAGCATGAGTATTCTCGAGAATACTCATGCTTGTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030262.2-228s1c1
Sequence:CCGGCGCTGTTGAAGACTGAAGAGTCTCGAGACTCTTCAGTCTTCAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030262.2-530s1c1
Sequence:CCGGGAGTATTACAGAGGCTGGTTTCTCGAGAAACCAGCCTCTGTAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030262
VALIDATED
POFUT2 MISSION shRNA shRNA Plasmid DNA
protein O-fucosyltransferase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030262.3-377s21c1
Sequence:CCGGCGTTATAGAGTATGAGCAGTTCTCGAGAACTGCTCATACTCTATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030262.3-238s21c1
Sequence:CCGGCGCTGTTGAAGACTGAAGAGTCTCGAGACTCTTCAGTCTTCAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030262.3-540s21c1
Sequence:CCGGGAGTATTACAGAGGCTGGTTTCTCGAGAAACCAGCCTCTGTAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030262.3-526s21c1
Sequence:CCGGCGCAGGACAAGCATGAGTATTCTCGAGAATACTCATGCTTGTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030262.2-366s1c1
Sequence:CCGGCCGTTATAGAGTATGAGCAGTCTCGAGACTGCTCATACTCTATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030262.2-367s1c1
Sequence:CCGGCGTTATAGAGTATGAGCAGTTCTCGAGAACTGCTCATACTCTATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030262.2-516s1c1
Sequence:CCGGCGCAGGACAAGCATGAGTATTCTCGAGAATACTCATGCTTGTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030262.2-228s1c1
Sequence:CCGGCGCTGTTGAAGACTGAAGAGTCTCGAGACTCTTCAGTCTTCAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030262.2-530s1c1
Sequence:CCGGGAGTATTACAGAGGCTGGTTTCTCGAGAAACCAGCCTCTGTAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030262
VALIDATED
POFUT2 MISSION shRNA Lentiviral Transduction Particles
protein O-fucosyltransferase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030262.3-377s21c1
Sequence:CCGGCGTTATAGAGTATGAGCAGTTCTCGAGAACTGCTCATACTCTATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030262.3-238s21c1
Sequence:CCGGCGCTGTTGAAGACTGAAGAGTCTCGAGACTCTTCAGTCTTCAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030262.3-540s21c1
Sequence:CCGGGAGTATTACAGAGGCTGGTTTCTCGAGAAACCAGCCTCTGTAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030262.3-526s21c1
Sequence:CCGGCGCAGGACAAGCATGAGTATTCTCGAGAATACTCATGCTTGTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030262.2-366s1c1
Sequence:CCGGCCGTTATAGAGTATGAGCAGTCTCGAGACTGCTCATACTCTATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030262.2-367s1c1
Sequence:CCGGCGTTATAGAGTATGAGCAGTTCTCGAGAACTGCTCATACTCTATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030262.2-516s1c1
Sequence:CCGGCGCAGGACAAGCATGAGTATTCTCGAGAATACTCATGCTTGTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030262.2-228s1c1
Sequence:CCGGCGCTGTTGAAGACTGAAGAGTCTCGAGACTCTTCAGTCTTCAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030262.2-530s1c1
Sequence:CCGGGAGTATTACAGAGGCTGGTTTCTCGAGAAACCAGCCTCTGTAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks