EMAIL THIS PAGE TO A FRIEND

POGLUT1

protein O-glucosyltransferase 1

Synonyms: C3orf9 CLP46 KDELCL1 KTELC1 MDSRP Rumi hCLP46
UniProtKB ID: Q8NBL1, B2RD13, Q53GJ4, Q8N2T1
Gene ID:
Mouse(224143) protein O-glucosyltransferase 1
Rat(288091) protein O-glucosyltransferase 1
domestic guinea pig(100736113) protein O-glucosyltransferase 1
naked mole-rat(101707033) protein O-glucosyltransferase 1
cow(511862) protein O-glucosyltransferase 1
sheep(101105708) protein O-glucosyltransferase 1
Zebrafish(641495) protein O-glucosyltransferase 1
chicken(418455) protein O-glucosyltransferase 1
Horse(100071030) protein O-glucosyltransferase 1
domestic cat(101088101) protein O-glucosyltransferase 1
dog(487993) protein O-glucosyltransferase 1
203 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1644 Human POGLUT1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152305 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020231 Rosetta Predictions human pricing
NM_152305 Rosetta Predictions human pricing
XM_001069417 Rosetta Predictions rat pricing
XM_221437 Rosetta Predictions rat pricing
NM_172380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235486 predicted 978
2 SASI_Hs01_00235489 predicted 1028
3 SASI_Hs01_00235490 predicted 1035
4 SASI_Hs02_00353182 predicted 949
5 SASI_Hs02_00353183 predicted 1030
6 SASI_Hs02_00353184 predicted 960
7 SASI_Hs01_00235494 predicted 978
8 SASI_Hs01_00235495 predicted 956
9 SASI_Hs02_00353185 predicted 1026
10 SASI_Hs02_00353186 predicted 977
11 SASI_Hs01_00235487 predicted 1501
12 SASI_Hs01_00235488 predicted 1503
13 SASI_Hs01_00235491 predicted 1558
14 SASI_Hs01_00235492 predicted 1532
15 SASI_Hs01_00235493 predicted 1634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188978 predicted 978
2 SASI_Hs01_00188981 predicted 1027
3 SASI_Hs01_00188982 predicted 1027
4 SASI_Hs02_00365879 predicted 952
5 SASI_Hs02_00365880 predicted 1026
6 SASI_Hs02_00365881 predicted 961
7 SASI_Hs01_00188986 predicted 983
8 SASI_Hs01_00188987 predicted 954
9 SASI_Hs02_00365882 predicted 1019
10 SASI_Hs02_00365883 predicted 981
11 SASI_Hs01_00188979 predicted 1500
12 SASI_Hs01_00188980 predicted 1497
13 SASI_Hs01_00188983 predicted 1566
14 SASI_Hs01_00188984 predicted 1532
15 SASI_Hs01_00188985 predicted 1632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327907 predicted 352
2 SASI_Rn02_00327908 predicted 1424
3 SASI_Rn02_00327909 predicted 1057
4 SASI_Rn02_00327910 predicted 956
5 SASI_Rn02_00327911 predicted 307
6 SASI_Rn02_00327912 predicted 1416
7 SASI_Rn02_00327913 predicted 1273
8 SASI_Rn02_00327914 predicted 273
9 SASI_Rn02_00327915 predicted 1162
10 SASI_Rn02_00327916 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380145 predicted 359
2 SASI_Rn02_00380146 predicted 1431
3 SASI_Rn02_00380147 predicted 1061
4 SASI_Rn02_00380148 predicted 949
5 SASI_Rn02_00380149 predicted 312
6 SASI_Rn02_00380150 predicted 1412
7 SASI_Rn02_00380151 predicted 1271
8 SASI_Rn02_00380152 predicted 275
9 SASI_Rn02_00380153 predicted 1166
10 SASI_Rn02_00380154 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174893 predicted 674
2 SASI_Mm02_00343821 predicted 674
3 SASI_Mm01_00174894 predicted 628
4 SASI_Mm01_00174895 predicted 397
5 SASI_Mm01_00174896 predicted 1259
6 SASI_Mm01_00174897 predicted 776
7 SASI_Mm01_00174898 predicted 890
8 SASI_Mm01_00174899 predicted 379
9 SASI_Mm01_00174900 predicted 798
10 SASI_Mm01_00174901 predicted 393
11 SASI_Mm01_00174902 predicted 778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152305
VALIDATED
POGLUT1 MISSION shRNA Bacterial Glycerol Stock
protein O-glucosyltransferase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152305.2-1255s21c1
Sequence:CCGGGAACTATAGTAGTCATCATAGCTCGAGCTATGATGACTACTATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152305.2-1331s21c1
Sequence:CCGGCCATAAGCTTGGCACCTATACCTCGAGGTATAGGTGCCAAGCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152305.2-465s21c1
Sequence:CCGGGGTGATCAATGTACGAGATTACTCGAGTAATCTCGTACATTGATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152305.1-1857s1c1
Sequence:CCGGCCACATAGAAAGAGGCCAATTCTCGAGAATTGGCCTCTTTCTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152305.1-465s1c1
Sequence:CCGGGAGATTATCCTCAGGTTCCTACTCGAGTAGGAACCTGAGGATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152305.1-893s1c1
Sequence:CCGGGCTGCAAGTTTCCGGTTTAAACTCGAGTTTAAACCGGAAACTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152305.1-1031s1c1
Sequence:CCGGGTCCAAGAGCTGTTACAATTTCTCGAGAAATTGTAACAGCTCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_152305.1-716s1c1
Sequence:CCGGCCAGAACGAGATCCTCTCATTCTCGAGAATGAGAGGATCTCGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152305.1-827s1c1
Sequence:CCGGGCTGCTAAGGATGTCCATCTTCTCGAGAAGATGGACATCCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152305
VALIDATED
POGLUT1 MISSION shRNA shRNA Plasmid DNA
protein O-glucosyltransferase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152305.2-1255s21c1
Sequence:CCGGGAACTATAGTAGTCATCATAGCTCGAGCTATGATGACTACTATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152305.2-1331s21c1
Sequence:CCGGCCATAAGCTTGGCACCTATACCTCGAGGTATAGGTGCCAAGCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152305.2-465s21c1
Sequence:CCGGGGTGATCAATGTACGAGATTACTCGAGTAATCTCGTACATTGATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152305.1-1857s1c1
Sequence:CCGGCCACATAGAAAGAGGCCAATTCTCGAGAATTGGCCTCTTTCTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152305.1-465s1c1
Sequence:CCGGGAGATTATCCTCAGGTTCCTACTCGAGTAGGAACCTGAGGATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152305.1-893s1c1
Sequence:CCGGGCTGCAAGTTTCCGGTTTAAACTCGAGTTTAAACCGGAAACTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152305.1-1031s1c1
Sequence:CCGGGTCCAAGAGCTGTTACAATTTCTCGAGAAATTGTAACAGCTCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_152305.1-716s1c1
Sequence:CCGGCCAGAACGAGATCCTCTCATTCTCGAGAATGAGAGGATCTCGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152305.1-827s1c1
Sequence:CCGGGCTGCTAAGGATGTCCATCTTCTCGAGAAGATGGACATCCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152305
VALIDATED
POGLUT1 MISSION shRNA Lentiviral Transduction Particles
protein O-glucosyltransferase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152305.2-1255s21c1
Sequence:CCGGGAACTATAGTAGTCATCATAGCTCGAGCTATGATGACTACTATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152305.2-1331s21c1
Sequence:CCGGCCATAAGCTTGGCACCTATACCTCGAGGTATAGGTGCCAAGCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152305.2-465s21c1
Sequence:CCGGGGTGATCAATGTACGAGATTACTCGAGTAATCTCGTACATTGATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152305.1-1857s1c1
Sequence:CCGGCCACATAGAAAGAGGCCAATTCTCGAGAATTGGCCTCTTTCTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152305.1-465s1c1
Sequence:CCGGGAGATTATCCTCAGGTTCCTACTCGAGTAGGAACCTGAGGATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152305.1-893s1c1
Sequence:CCGGGCTGCAAGTTTCCGGTTTAAACTCGAGTTTAAACCGGAAACTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152305.1-1031s1c1
Sequence:CCGGGTCCAAGAGCTGTTACAATTTCTCGAGAAATTGTAACAGCTCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_152305.1-716s1c1
Sequence:CCGGCCAGAACGAGATCCTCTCATTCTCGAGAATGAGAGGATCTCGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152305.1-827s1c1
Sequence:CCGGGCTGCTAAGGATGTCCATCTTCTCGAGAAGATGGACATCCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172380
VALIDATED
POGLUT1 MISSION shRNA Bacterial Glycerol Stock
protein O-glucosyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172380.1-1468s1c1
Sequence:CCGGCGGGTCATCTACGTGTGTTATCTCGAGATAACACACGTAGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172380.1-1048s1c1
Sequence:CCGGCCAGTTCATCATAAACCATTTCTCGAGAAATGGTTTATGATGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172380.1-793s1c1
Sequence:CCGGCCTCATAGATCACTGCAAATACTCGAGTATTTGCAGTGATCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172380.1-385s1c1
Sequence:CCGGCCCTGACATGGAAATGGTAATCTCGAGATTACCATTTCCATGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172380.1-289s1c1
Sequence:CCGGGATCATTAAGAACCGGTTATTCTCGAGAATAACCGGTTCTTAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172380
VALIDATED
POGLUT1 MISSION shRNA shRNA Plasmid DNA
protein O-glucosyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172380.1-1468s1c1
Sequence:CCGGCGGGTCATCTACGTGTGTTATCTCGAGATAACACACGTAGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172380.1-1048s1c1
Sequence:CCGGCCAGTTCATCATAAACCATTTCTCGAGAAATGGTTTATGATGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172380.1-793s1c1
Sequence:CCGGCCTCATAGATCACTGCAAATACTCGAGTATTTGCAGTGATCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172380.1-385s1c1
Sequence:CCGGCCCTGACATGGAAATGGTAATCTCGAGATTACCATTTCCATGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172380.1-289s1c1
Sequence:CCGGGATCATTAAGAACCGGTTATTCTCGAGAATAACCGGTTCTTAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172380
VALIDATED
POGLUT1 MISSION shRNA Lentiviral Transduction Particles
protein O-glucosyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172380.1-1468s1c1
Sequence:CCGGCGGGTCATCTACGTGTGTTATCTCGAGATAACACACGTAGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172380.1-1048s1c1
Sequence:CCGGCCAGTTCATCATAAACCATTTCTCGAGAAATGGTTTATGATGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172380.1-793s1c1
Sequence:CCGGCCTCATAGATCACTGCAAATACTCGAGTATTTGCAGTGATCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172380.1-385s1c1
Sequence:CCGGCCCTGACATGGAAATGGTAATCTCGAGATTACCATTTCCATGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172380.1-289s1c1
Sequence:CCGGGATCATTAAGAACCGGTTATTCTCGAGAATAACCGGTTCTTAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks