EMAIL THIS PAGE TO A FRIEND

POLD2

polymerase (DNA directed), delta 2, accessory subunit

UniProtKB ID: P49005
Gene ID:
Human(5425) Summary: This gene encodes the 50-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein is required for the stimulation of DNA polymerase delta activity by the processivity cofactor proliferating cell nuclear antigen (PCNA). Expression of this gene may be a marker for ovarian carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Mar 2012]
Mouse(18972) polymerase (DNA directed), delta 2, regulatory subunit
Rat(289758) polymerase (DNA directed), delta 2, accessory subunit
Thale Cress(818812) DNA polymerase delta subunit 2
Zebrafish(796456) polymerase (DNA directed), delta 2, regulatory subunit
domestic cat(101095089) polymerase (DNA directed), delta 2, accessory subunit
dog(482686) polymerase (DNA directed), delta 2, accessory subunit
chicken(100859398) polymerase (DNA directed), delta 2, accessory subunit
cow(281991) polymerase (DNA directed), delta 2, regulatory subunit 50kDa
sheep(101117838) polymerase (DNA directed), delta 2, accessory subunit
domestic guinea pig(100727561) polymerase (DNA directed), delta 2, accessory subunit
naked mole-rat(101722261) polymerase (DNA directed), delta 2, accessory subunit
Domestic Rabbit(100358263) polymerase (DNA directed), delta 2, accessory subunit
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006230 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127218 Rosetta Predictions human pricing
NM_006230 Rosetta Predictions human pricing
NM_001013050 Rosetta Predictions rat pricing
NM_008894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328847 predicted 1019
2 SASI_Hs02_00328848 predicted 840
3 SASI_Hs02_00328849 predicted 1147
4 SASI_Hs02_00328850 predicted 1150
5 SASI_Hs02_00328851 predicted 1031
6 SASI_Hs02_00328852 predicted 758
7 SASI_Hs02_00328853 predicted 1268
8 SASI_Hs02_00328854 predicted 493
9 SASI_Hs02_00328855 predicted 1400
10 SASI_Hs02_00328856 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107103 predicted 846
2 SASI_Hs01_00107104 predicted 663
3 SASI_Hs01_00107105 predicted 983
4 SASI_Hs01_00107106 predicted 980
5 SASI_Hs01_00107107 predicted 852
6 SASI_Hs01_00107108 predicted 582
7 SASI_Hs01_00107109 predicted 1092
8 SASI_Hs01_00107110 predicted 326
9 SASI_Hs02_00341145 predicted 1222
10 SASI_Hs01_00107111 predicted 807
11 SASI_Hs01_00107102 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055008 predicted 512
2 SASI_Rn01_00055009 predicted 563
3 SASI_Rn01_00055010 predicted 1126
4 SASI_Rn01_00055011 predicted 960
5 SASI_Rn01_00055012 predicted 212
6 SASI_Rn01_00055014 predicted 1262
7 SASI_Rn01_00055015 predicted 565
8 SASI_Rn02_00200656 predicted 1294
9 SASI_Rn01_00055016 predicted 1267
10 SASI_Rn01_00055017 predicted 886
11 SASI_Rn01_00055013 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149622 predicted 1269
2 SASI_Mm01_00149623 predicted 560
3 SASI_Mm01_00149624 predicted 970
4 SASI_Mm01_00149625 predicted 460
5 SASI_Mm02_00314907 predicted 497
6 SASI_Mm01_00149626 predicted 589
7 SASI_Mm01_00149627 predicted 514
8 SASI_Mm01_00149628 predicted 918
9 SASI_Mm01_00149630 predicted 660
10 SASI_Mm01_00149631 predicted 1127
11 SASI_Mm01_00149629 predicted 1135
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008894
VALIDATED
POLD2 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), delta 2, accessory subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008894.2-346s21c1
Sequence:CCGGGCCGAGTTGAAGTGAAGAAGTCTCGAGACTTCTTCACTTCAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008894.2-262s21c1
Sequence:CCGGACCGGCAGTACGCCCATATTTCTCGAGAAATATGGGCGTACTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008894.2-686s21c1
Sequence:CCGGCCCACTTGACACAGACAGATTCTCGAGAATCTGTCTGTGTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008894.2-903s21c1
Sequence:CCGGGCCAAATACCTTACCAAGAAACTCGAGTTTCTTGGTAAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-308s1c1
Sequence:CCGGCCGAGTTGAAGTGAAGAAGTTCTCGAGAACTTCTTCACTTCAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-1127s1c1
Sequence:CCGGCGTGAGTGATATCTTCCGGTACTCGAGTACCGGAAGATATCACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-647s1c1
Sequence:CCGGCCCACTTGACACAGACAGATTCTCGAGAATCTGTCTGTGTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-864s1c1
Sequence:CCGGGCCAAATACCTTACCAAGAAACTCGAGTTTCTTGGTAAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-307s1c1
Sequence:CCGGGCCGAGTTGAAGTGAAGAAGTCTCGAGACTTCTTCACTTCAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008894
VALIDATED
POLD2 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), delta 2, accessory subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008894.2-346s21c1
Sequence:CCGGGCCGAGTTGAAGTGAAGAAGTCTCGAGACTTCTTCACTTCAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008894.2-262s21c1
Sequence:CCGGACCGGCAGTACGCCCATATTTCTCGAGAAATATGGGCGTACTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008894.2-686s21c1
Sequence:CCGGCCCACTTGACACAGACAGATTCTCGAGAATCTGTCTGTGTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008894.2-903s21c1
Sequence:CCGGGCCAAATACCTTACCAAGAAACTCGAGTTTCTTGGTAAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-308s1c1
Sequence:CCGGCCGAGTTGAAGTGAAGAAGTTCTCGAGAACTTCTTCACTTCAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-1127s1c1
Sequence:CCGGCGTGAGTGATATCTTCCGGTACTCGAGTACCGGAAGATATCACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-647s1c1
Sequence:CCGGCCCACTTGACACAGACAGATTCTCGAGAATCTGTCTGTGTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-864s1c1
Sequence:CCGGGCCAAATACCTTACCAAGAAACTCGAGTTTCTTGGTAAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-307s1c1
Sequence:CCGGGCCGAGTTGAAGTGAAGAAGTCTCGAGACTTCTTCACTTCAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008894
VALIDATED
POLD2 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), delta 2, accessory subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008894.2-346s21c1
Sequence:CCGGGCCGAGTTGAAGTGAAGAAGTCTCGAGACTTCTTCACTTCAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008894.2-262s21c1
Sequence:CCGGACCGGCAGTACGCCCATATTTCTCGAGAAATATGGGCGTACTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008894.2-686s21c1
Sequence:CCGGCCCACTTGACACAGACAGATTCTCGAGAATCTGTCTGTGTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008894.2-903s21c1
Sequence:CCGGGCCAAATACCTTACCAAGAAACTCGAGTTTCTTGGTAAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-308s1c1
Sequence:CCGGCCGAGTTGAAGTGAAGAAGTTCTCGAGAACTTCTTCACTTCAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-1127s1c1
Sequence:CCGGCGTGAGTGATATCTTCCGGTACTCGAGTACCGGAAGATATCACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-647s1c1
Sequence:CCGGCCCACTTGACACAGACAGATTCTCGAGAATCTGTCTGTGTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-864s1c1
Sequence:CCGGGCCAAATACCTTACCAAGAAACTCGAGTTTCTTGGTAAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008894.1-307s1c1
Sequence:CCGGGCCGAGTTGAAGTGAAGAAGTCTCGAGACTTCTTCACTTCAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006230
VALIDATED
POLD2 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), delta 2, accessory subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006230.2-658s21c1
Sequence:CCGGCCCACTTGACACAGATAGGTTCTCGAGAACCTATCTGTGTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006230.2-875s21c1
Sequence:CCGGGCCAAATACCTCACCAAGAAACTCGAGTTTCTTGGTGAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006230.2-1095s21c1
Sequence:CCGGCCACCATTGATGGAGTCAGATCTCGAGATCTGACTCCATCAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006230.2-985s21c1
Sequence:CCGGCGAGTTTGATCCCACCAATTACTCGAGTAATTGGTGGGATCAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-1079s1c1
Sequence:CCGGCCACCATTGATGGAGTCAGATCTCGAGATCTGACTCCATCAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-969s1c1
Sequence:CCGGCGAGTTTGATCCCACCAATTACTCGAGTAATTGGTGGGATCAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-249s1c1
Sequence:CCGGCCTCATCCAAATGAGACCCTTCTCGAGAAGGGTCTCATTTGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-642s1c1
Sequence:CCGGCCCACTTGACACAGATAGGTTCTCGAGAACCTATCTGTGTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-859s1c1
Sequence:CCGGGCCAAATACCTCACCAAGAAACTCGAGTTTCTTGGTGAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006230
VALIDATED
POLD2 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), delta 2, accessory subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006230.2-658s21c1
Sequence:CCGGCCCACTTGACACAGATAGGTTCTCGAGAACCTATCTGTGTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006230.2-875s21c1
Sequence:CCGGGCCAAATACCTCACCAAGAAACTCGAGTTTCTTGGTGAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006230.2-1095s21c1
Sequence:CCGGCCACCATTGATGGAGTCAGATCTCGAGATCTGACTCCATCAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006230.2-985s21c1
Sequence:CCGGCGAGTTTGATCCCACCAATTACTCGAGTAATTGGTGGGATCAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-1079s1c1
Sequence:CCGGCCACCATTGATGGAGTCAGATCTCGAGATCTGACTCCATCAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-969s1c1
Sequence:CCGGCGAGTTTGATCCCACCAATTACTCGAGTAATTGGTGGGATCAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-249s1c1
Sequence:CCGGCCTCATCCAAATGAGACCCTTCTCGAGAAGGGTCTCATTTGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-642s1c1
Sequence:CCGGCCCACTTGACACAGATAGGTTCTCGAGAACCTATCTGTGTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-859s1c1
Sequence:CCGGGCCAAATACCTCACCAAGAAACTCGAGTTTCTTGGTGAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006230
VALIDATED
POLD2 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), delta 2, accessory subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006230.2-658s21c1
Sequence:CCGGCCCACTTGACACAGATAGGTTCTCGAGAACCTATCTGTGTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006230.2-875s21c1
Sequence:CCGGGCCAAATACCTCACCAAGAAACTCGAGTTTCTTGGTGAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006230.2-1095s21c1
Sequence:CCGGCCACCATTGATGGAGTCAGATCTCGAGATCTGACTCCATCAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006230.2-985s21c1
Sequence:CCGGCGAGTTTGATCCCACCAATTACTCGAGTAATTGGTGGGATCAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-1079s1c1
Sequence:CCGGCCACCATTGATGGAGTCAGATCTCGAGATCTGACTCCATCAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-969s1c1
Sequence:CCGGCGAGTTTGATCCCACCAATTACTCGAGTAATTGGTGGGATCAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-249s1c1
Sequence:CCGGCCTCATCCAAATGAGACCCTTCTCGAGAAGGGTCTCATTTGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-642s1c1
Sequence:CCGGCCCACTTGACACAGATAGGTTCTCGAGAACCTATCTGTGTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006230.1-859s1c1
Sequence:CCGGGCCAAATACCTCACCAAGAAACTCGAGTTTCTTGGTGAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks