EMAIL THIS PAGE TO A FRIEND

POLD3

polymerase (DNA-directed), delta 3, accessory subunit

Synonyms: P66 P68
UniProtKB ID: Q15054, B7ZAI6
Gene ID:
Human(10714) Summary: This gene encodes the 66-kDa subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein plays a role in regulating the activity of DNA polymerase delta through interactions with other subunits and the processivity cofactor proliferating cell nuclear antigen (PCNA). Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
Mouse(67967) polymerase (DNA-directed), delta 3, accessory subunit
Rat(293144) polymerase (DNA-directed), delta 3, accessory subunit
Thale Cress(844201) DNA polymerase delta 3
Horse(100051966) polymerase (DNA-directed), delta 3, accessory subunit
domestic cat(101093711) polymerase (DNA-directed), delta 3, accessory subunit
dog(476806) polymerase (DNA-directed), delta 3, accessory subunit
chicken(419053) polymerase (DNA-directed), delta 3, accessory subunit
Zebrafish(692256) polymerase (DNA-directed), delta 3, accessory subunit
Domestic Rabbit(100357626) polymerase (DNA-directed), delta 3, accessory subunit
naked mole-rat(101708160) polymerase (DNA-directed), delta 3, accessory subunit
domestic guinea pig(100734598) polymerase (DNA-directed), delta 3, accessory subunit
cow(537616) polymerase (DNA-directed), delta 3, accessory subunit
sheep(101106622) polymerase (DNA-directed), delta 3, accessory subunit
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006591 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133692 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133692 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133692 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012621 MISSION® esiRNA esiRNA targeting human POLD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006591 Rosetta Predictions human pricing
NM_001024750 Rosetta Predictions rat pricing
NM_133692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034560 predicted 266
2 SASI_Hs01_00034561 predicted 1522
3 SASI_Hs01_00034562 predicted 1442
4 SASI_Hs01_00034563 predicted 1306
5 SASI_Hs01_00034564 predicted 539
6 SASI_Hs01_00034565 predicted 686
7 SASI_Hs01_00034566 predicted 689
8 SASI_Hs01_00034567 predicted 557
9 SASI_Hs01_00034568 predicted 1532
10 SASI_Hs01_00034569 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075450 predicted 202
2 SASI_Rn01_00075451 predicted 544
3 SASI_Rn01_00075452 predicted 481
4 SASI_Rn01_00075453 predicted 290
5 SASI_Rn01_00075454 predicted 550
6 SASI_Rn01_00075455 predicted 778
7 SASI_Rn01_00075456 predicted 1441
8 SASI_Rn02_00202626 predicted 1052
9 SASI_Rn01_00075458 predicted 1454
10 SASI_Rn01_00075459 predicted 386
11 SASI_Rn01_00075457 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044439 predicted 459
2 SASI_Mm01_00044440 predicted 521
3 SASI_Mm01_00044441 predicted 793
4 SASI_Mm01_00044442 predicted 716
5 SASI_Mm01_00044443 predicted 265
6 SASI_Mm02_00338654 predicted 809
7 SASI_Mm01_00044444 predicted 1040
8 SASI_Mm02_00338655 predicted 816
9 SASI_Mm01_00044445 predicted 288
10 SASI_Mm01_00044446 predicted 908
11 SASI_Mm01_00044447 predicted 1242
12 SASI_Mm01_00044448 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006591
VALIDATED
POLD3 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA-directed), delta 3, accessory subunit
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-982s1c1
Sequence:CCGGCGAGTAGCATTATCTGATGATCTCGAGATCATCAGATAATGCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-639s1c1
Sequence:CCGGGCCCAAAGGAATTATGGGAATCTCGAGATTCCCATAATTCCTTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-1453s1c1
Sequence:CCGGACTGGCTTCTTCCAGAGGAAACTCGAGTTTCCTCTGGAAGAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-412s1c1
Sequence:CCGGCCTCTGTTCAATACTGACTATCTCGAGATAGTCAGTATTGAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-380s1c1
Sequence:CCGGGCATCCAGAAAGCCATGCTAACTCGAGTTAGCATGGCTTTCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-380s1c2
Sequence:CCGGGCATCCAGAAAGCCATGCTAACTCGAGTTAGCATGGCTTTCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006591.1-309s21c1
Sequence:CCGGAGTAGTGAGAGAAGATAAATTCTCGAGAATTTATCTTCTCTCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006591.1-461s21c1
Sequence:CCGGGCAGCAAATTTAGTGCTATACCTCGAGGTATAGCACTAAATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006591.1-2213s21c1
Sequence:CCGGCGAGTCAGCATTGACGATATTCTCGAGAATATCGTCAATGCTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006591.1-1309s21c1
Sequence:CCGGGATAGTGAAGAGGAGCTTAACCTCGAGGTTAAGCTCCTCTTCACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006591.1-424s21c1
Sequence:CCGGACTGACTATGACATCCTTAAACTCGAGTTTAAGGATGTCATAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006591
VALIDATED
POLD3 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA-directed), delta 3, accessory subunit
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-982s1c1
Sequence:CCGGCGAGTAGCATTATCTGATGATCTCGAGATCATCAGATAATGCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-639s1c1
Sequence:CCGGGCCCAAAGGAATTATGGGAATCTCGAGATTCCCATAATTCCTTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-1453s1c1
Sequence:CCGGACTGGCTTCTTCCAGAGGAAACTCGAGTTTCCTCTGGAAGAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-412s1c1
Sequence:CCGGCCTCTGTTCAATACTGACTATCTCGAGATAGTCAGTATTGAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-380s1c1
Sequence:CCGGGCATCCAGAAAGCCATGCTAACTCGAGTTAGCATGGCTTTCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-380s1c2
Sequence:CCGGGCATCCAGAAAGCCATGCTAACTCGAGTTAGCATGGCTTTCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006591.1-309s21c1
Sequence:CCGGAGTAGTGAGAGAAGATAAATTCTCGAGAATTTATCTTCTCTCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006591.1-461s21c1
Sequence:CCGGGCAGCAAATTTAGTGCTATACCTCGAGGTATAGCACTAAATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006591.1-2213s21c1
Sequence:CCGGCGAGTCAGCATTGACGATATTCTCGAGAATATCGTCAATGCTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006591.1-1309s21c1
Sequence:CCGGGATAGTGAAGAGGAGCTTAACCTCGAGGTTAAGCTCCTCTTCACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006591.1-424s21c1
Sequence:CCGGACTGACTATGACATCCTTAAACTCGAGTTTAAGGATGTCATAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006591
VALIDATED
POLD3 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA-directed), delta 3, accessory subunit
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-982s1c1
Sequence:CCGGCGAGTAGCATTATCTGATGATCTCGAGATCATCAGATAATGCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-639s1c1
Sequence:CCGGGCCCAAAGGAATTATGGGAATCTCGAGATTCCCATAATTCCTTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-1453s1c1
Sequence:CCGGACTGGCTTCTTCCAGAGGAAACTCGAGTTTCCTCTGGAAGAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-412s1c1
Sequence:CCGGCCTCTGTTCAATACTGACTATCTCGAGATAGTCAGTATTGAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-380s1c1
Sequence:CCGGGCATCCAGAAAGCCATGCTAACTCGAGTTAGCATGGCTTTCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006591.1-380s1c2
Sequence:CCGGGCATCCAGAAAGCCATGCTAACTCGAGTTAGCATGGCTTTCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006591.1-309s21c1
Sequence:CCGGAGTAGTGAGAGAAGATAAATTCTCGAGAATTTATCTTCTCTCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006591.1-461s21c1
Sequence:CCGGGCAGCAAATTTAGTGCTATACCTCGAGGTATAGCACTAAATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006591.1-2213s21c1
Sequence:CCGGCGAGTCAGCATTGACGATATTCTCGAGAATATCGTCAATGCTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006591.1-1309s21c1
Sequence:CCGGGATAGTGAAGAGGAGCTTAACCTCGAGGTTAAGCTCCTCTTCACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006591.1-424s21c1
Sequence:CCGGACTGACTATGACATCCTTAAACTCGAGTTTAAGGATGTCATAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133692
VALIDATED
POLD3 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA-directed), delta 3, accessory subunit
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133692.1-1212s1c1
Sequence:CCGGGAAAGCGTGTACTGAAATCTACTCGAGTAGATTTCAGTACACGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133692.1-2157s1c1
Sequence:CCGGGCATATACTCATGTGTGGTTTCTCGAGAAACCACACATGAGTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133692.1-532s1c1
Sequence:CCGGCAGAAAGTATGAACAGTCAAACTCGAGTTTGACTGTTCATACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133692.1-286s1c1
Sequence:CCGGGAACGGACATTCTTGCCACAACTCGAGTTGTGGCAAGAATGTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133692.1-720s1c1
Sequence:CCGGGAGAAGTAACCAGTGCATCTTCTCGAGAAGATGCACTGGTTACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133692.2-530s21c1
Sequence:CCGGCAGAAAGTATGAACAGTCAAACTCGAGTTTGACTGTTCATACTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216245    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133692.2-2183s1c1
Sequence:CCGGCCAGATTTCCTATACTTATTACTCGAGTAATAAGTATAGGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133692.2-824s1c1
Sequence:CCGGGGATTCAGAACAAGCAGTAAACTCGAGTTTACTGCTTGTTCTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133692.2-383s21c1
Sequence:CCGGCATCCAGAAAGCTATGCTAAACTCGAGTTTAGCATAGCTTTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133692.2-426s21c1
Sequence:CCGGACCGACTATGACATCCTTAAACTCGAGTTTAAGGATGTCATAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133692.2-142s21c1
Sequence:CCGGCTTACAAGTGGCTAAGCTATACTCGAGTATAGCTTAGCCACTTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133692.2-1922s21c1
Sequence:CCGGTTAGTCAGATGAGAAGCTAAACTCGAGTTTAGCTTCTCATCTGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133692
VALIDATED
POLD3 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA-directed), delta 3, accessory subunit
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133692.1-1212s1c1
Sequence:CCGGGAAAGCGTGTACTGAAATCTACTCGAGTAGATTTCAGTACACGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133692.1-2157s1c1
Sequence:CCGGGCATATACTCATGTGTGGTTTCTCGAGAAACCACACATGAGTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133692.1-532s1c1
Sequence:CCGGCAGAAAGTATGAACAGTCAAACTCGAGTTTGACTGTTCATACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133692.1-286s1c1
Sequence:CCGGGAACGGACATTCTTGCCACAACTCGAGTTGTGGCAAGAATGTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133692.1-720s1c1
Sequence:CCGGGAGAAGTAACCAGTGCATCTTCTCGAGAAGATGCACTGGTTACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133692.2-530s21c1
Sequence:CCGGCAGAAAGTATGAACAGTCAAACTCGAGTTTGACTGTTCATACTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216245    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133692.2-2183s1c1
Sequence:CCGGCCAGATTTCCTATACTTATTACTCGAGTAATAAGTATAGGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133692.2-824s1c1
Sequence:CCGGGGATTCAGAACAAGCAGTAAACTCGAGTTTACTGCTTGTTCTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133692.2-383s21c1
Sequence:CCGGCATCCAGAAAGCTATGCTAAACTCGAGTTTAGCATAGCTTTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133692.2-426s21c1
Sequence:CCGGACCGACTATGACATCCTTAAACTCGAGTTTAAGGATGTCATAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133692.2-142s21c1
Sequence:CCGGCTTACAAGTGGCTAAGCTATACTCGAGTATAGCTTAGCCACTTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133692.2-1922s21c1
Sequence:CCGGTTAGTCAGATGAGAAGCTAAACTCGAGTTTAGCTTCTCATCTGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133692
VALIDATED
POLD3 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA-directed), delta 3, accessory subunit
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133692.1-1212s1c1
Sequence:CCGGGAAAGCGTGTACTGAAATCTACTCGAGTAGATTTCAGTACACGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133692.1-2157s1c1
Sequence:CCGGGCATATACTCATGTGTGGTTTCTCGAGAAACCACACATGAGTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133692.1-532s1c1
Sequence:CCGGCAGAAAGTATGAACAGTCAAACTCGAGTTTGACTGTTCATACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133692.1-286s1c1
Sequence:CCGGGAACGGACATTCTTGCCACAACTCGAGTTGTGGCAAGAATGTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133692.1-720s1c1
Sequence:CCGGGAGAAGTAACCAGTGCATCTTCTCGAGAAGATGCACTGGTTACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133692.2-530s21c1
Sequence:CCGGCAGAAAGTATGAACAGTCAAACTCGAGTTTGACTGTTCATACTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216245    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133692.2-2183s1c1
Sequence:CCGGCCAGATTTCCTATACTTATTACTCGAGTAATAAGTATAGGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133692.2-824s1c1
Sequence:CCGGGGATTCAGAACAAGCAGTAAACTCGAGTTTACTGCTTGTTCTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133692.2-383s21c1
Sequence:CCGGCATCCAGAAAGCTATGCTAAACTCGAGTTTAGCATAGCTTTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133692.2-426s21c1
Sequence:CCGGACCGACTATGACATCCTTAAACTCGAGTTTAAGGATGTCATAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133692.2-142s21c1
Sequence:CCGGCTTACAAGTGGCTAAGCTATACTCGAGTATAGCTTAGCCACTTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133692.2-1922s21c1
Sequence:CCGGTTAGTCAGATGAGAAGCTAAACTCGAGTTTAGCTTCTCATCTGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks