EMAIL THIS PAGE TO A FRIEND

POLI

polymerase (DNA directed) iota

Synonyms: RAD30B RAD3OB
UniProtKB ID: Q9UNA4, Q8N590, Q9H0S1, Q9NYH6
Gene ID:
Mouse(26447) polymerase (DNA directed), iota
Rat(291526) polymerase (DNA directed), iota
Zebrafish(550532) polymerase (DNA directed) iota
domestic cat(101099086) polymerase (DNA directed) iota
dog(100683243) polymerase (DNA directed) iota
cow(515909) polymerase (DNA directed) iota
sheep(101119174) polymerase (DNA directed) iota
domestic guinea pig(100734922) polymerase (DNA directed) iota
naked mole-rat(101707390) polymerase (DNA directed) iota
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007195 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011972 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011972 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011972 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007195 Rosetta Predictions human pricing
NM_001106137 Rosetta Predictions rat pricing
NM_011972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343171 predicted 529
2 SASI_Hs01_00078208 predicted 1382
3 SASI_Hs02_00343172 predicted 2369
4 SASI_Hs01_00078209 predicted 429
5 SASI_Hs01_00078210 predicted 2078
6 SASI_Hs02_00343173 predicted 848
7 SASI_Hs01_00078211 predicted 1572
8 SASI_Hs01_00078214 predicted 1823
9 SASI_Hs01_00078216 predicted 1794
10 SASI_Hs01_00078217 predicted 1640
11 SASI_Hs01_00078212 predicted 1243
12 SASI_Hs01_00078213 predicted 1211
13 SASI_Hs01_00078215 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215988 predicted 1896
2 SASI_Rn02_00215989 predicted 2123
3 SASI_Rn02_00215990 predicted 1867
4 SASI_Rn02_00215991 predicted 1474
5 SASI_Rn02_00215992 predicted 230
6 SASI_Rn02_00215993 predicted 684
7 SASI_Rn02_00215994 predicted 802
8 SASI_Rn02_00215995 predicted 1678
9 SASI_Rn02_00215996 predicted 747
10 SASI_Rn02_00215997 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106262 predicted 1863
2 SASI_Mm01_00106263 predicted 1264
3 SASI_Mm01_00106265 predicted 835
4 SASI_Mm01_00106266 predicted 1231
5 SASI_Mm01_00106267 predicted 752
6 SASI_Mm01_00106268 predicted 800
7 SASI_Mm01_00106269 predicted 1472
8 SASI_Mm01_00106270 predicted 868
9 SASI_Mm01_00106271 predicted 378
10 SASI_Mm02_00321868 predicted 605
11 SASI_Mm01_00106264 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007195
POLI MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed) iota
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-1216s21c1
Sequence:CCGGAGAGTCGTCAGTGCCCTATTCCTCGAGGAATAGGGCACTGACGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-403s21c1
Sequence:CCGGAGTGTCCACAGTTGGTATTAGCTCGAGCTAATACCAACTGTGGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-1966s21c1
Sequence:CCGGGAATAAGTCAAGGACCTAAAGCTCGAGCTTTAGGTCCTTGACTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-603s21c1
Sequence:CCGGTCGGGTCATGTATACAATAATCTCGAGATTATTGTATACATGACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007195.2-2382s21c1
Sequence:CCGGGATATTCAATAACGGAGTAAACTCGAGTTTACTCCGTTATTGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-328s21c1
Sequence:CCGGTGGTGGTTACCTGCAACTATGCTCGAGCATAGTTGCAGGTAACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007195.2-2317s21c1
Sequence:CCGGAGCAAGGGAATACCATTATTTCTCGAGAAATAATGGTATTCCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007195.2-2710s21c1
Sequence:CCGGTACTGCCAACTAACCTATTAACTCGAGTTAATAGGTTAGTTGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-812s21c1
Sequence:CCGGTGAAAGTTGTCAACATCTTATCTCGAGATAAGATGTTGACAACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-1296s1c1
Sequence:CCGGGCAACCTTAAAGCACTAAATACTCGAGTATTTAGTGCTTTAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-959s1c1
Sequence:CCGGCCTCAGTCCTTTAGTGAAGAACTCGAGTTCTTCACTAAAGGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-2016s1c1
Sequence:CCGGGCCATAAGCAAACAGTAGCAACTCGAGTTGCTACTGTTTGCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-2072s1c1
Sequence:CCGGCCAGATTCTGTTGATGAGAAACTCGAGTTTCTCATCAACAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-363s1c1
Sequence:CCGGCCCGCTACAGAGAAATGTCTTCTCGAGAAGACATTTCTCTGTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007195
POLI MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed) iota
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-1216s21c1
Sequence:CCGGAGAGTCGTCAGTGCCCTATTCCTCGAGGAATAGGGCACTGACGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-403s21c1
Sequence:CCGGAGTGTCCACAGTTGGTATTAGCTCGAGCTAATACCAACTGTGGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-1966s21c1
Sequence:CCGGGAATAAGTCAAGGACCTAAAGCTCGAGCTTTAGGTCCTTGACTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-603s21c1
Sequence:CCGGTCGGGTCATGTATACAATAATCTCGAGATTATTGTATACATGACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007195.2-2382s21c1
Sequence:CCGGGATATTCAATAACGGAGTAAACTCGAGTTTACTCCGTTATTGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-328s21c1
Sequence:CCGGTGGTGGTTACCTGCAACTATGCTCGAGCATAGTTGCAGGTAACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007195.2-2317s21c1
Sequence:CCGGAGCAAGGGAATACCATTATTTCTCGAGAAATAATGGTATTCCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007195.2-2710s21c1
Sequence:CCGGTACTGCCAACTAACCTATTAACTCGAGTTAATAGGTTAGTTGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-812s21c1
Sequence:CCGGTGAAAGTTGTCAACATCTTATCTCGAGATAAGATGTTGACAACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-1296s1c1
Sequence:CCGGGCAACCTTAAAGCACTAAATACTCGAGTATTTAGTGCTTTAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-959s1c1
Sequence:CCGGCCTCAGTCCTTTAGTGAAGAACTCGAGTTCTTCACTAAAGGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-2016s1c1
Sequence:CCGGGCCATAAGCAAACAGTAGCAACTCGAGTTGCTACTGTTTGCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-2072s1c1
Sequence:CCGGCCAGATTCTGTTGATGAGAAACTCGAGTTTCTCATCAACAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-363s1c1
Sequence:CCGGCCCGCTACAGAGAAATGTCTTCTCGAGAAGACATTTCTCTGTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007195
POLI MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed) iota
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-1216s21c1
Sequence:CCGGAGAGTCGTCAGTGCCCTATTCCTCGAGGAATAGGGCACTGACGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-403s21c1
Sequence:CCGGAGTGTCCACAGTTGGTATTAGCTCGAGCTAATACCAACTGTGGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-1966s21c1
Sequence:CCGGGAATAAGTCAAGGACCTAAAGCTCGAGCTTTAGGTCCTTGACTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-603s21c1
Sequence:CCGGTCGGGTCATGTATACAATAATCTCGAGATTATTGTATACATGACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007195.2-2382s21c1
Sequence:CCGGGATATTCAATAACGGAGTAAACTCGAGTTTACTCCGTTATTGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-328s21c1
Sequence:CCGGTGGTGGTTACCTGCAACTATGCTCGAGCATAGTTGCAGGTAACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007195.2-2317s21c1
Sequence:CCGGAGCAAGGGAATACCATTATTTCTCGAGAAATAATGGTATTCCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007195.2-2710s21c1
Sequence:CCGGTACTGCCAACTAACCTATTAACTCGAGTTAATAGGTTAGTTGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007195.2-812s21c1
Sequence:CCGGTGAAAGTTGTCAACATCTTATCTCGAGATAAGATGTTGACAACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-1296s1c1
Sequence:CCGGGCAACCTTAAAGCACTAAATACTCGAGTATTTAGTGCTTTAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-959s1c1
Sequence:CCGGCCTCAGTCCTTTAGTGAAGAACTCGAGTTCTTCACTAAAGGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-2016s1c1
Sequence:CCGGGCCATAAGCAAACAGTAGCAACTCGAGTTGCTACTGTTTGCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-2072s1c1
Sequence:CCGGCCAGATTCTGTTGATGAGAAACTCGAGTTTCTCATCAACAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007195.1-363s1c1
Sequence:CCGGCCCGCTACAGAGAAATGTCTTCTCGAGAAGACATTTCTCTGTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011972
VALIDATED
POLI MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed) iota
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011972.1-683s21c1
Sequence:CCGGGCCGGAGTGGCTCCTAATAAACTCGAGTTTATTAGGAGCCACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011972.1-2323s21c1
Sequence:CCGGATCCGATGTAAGATGTAATAGCTCGAGCTATTACATCTTACATCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011972.1-809s21c1
Sequence:CCGGATTCCTGGTATCGGCTATAAACTCGAGTTTATAGCCGATACCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011972.1-1001s21c1
Sequence:CCGGAGTGAAGAAGATACGTTTAAACTCGAGTTTAAACGTATCTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011972.1-1611s21c1
Sequence:CCGGAGCAACTTCCAGCAGATATTCCTCGAGGAATATCTGCTGGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011972.1-2284s1c1
Sequence:CCGGCCAGGGCATAACCAAATAGAACTCGAGTTCTATTTGGTTATGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011972.1-1043s1c1
Sequence:CCGGGCTAAAGCTAAGATTGAAGAACTCGAGTTCTTCAATCTTAGCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011972.1-692s1c1
Sequence:CCGGGCTCCTAATAAACTCTTGGCACTCGAGTGCCAAGAGTTTATTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011972
VALIDATED
POLI MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed) iota
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011972.1-683s21c1
Sequence:CCGGGCCGGAGTGGCTCCTAATAAACTCGAGTTTATTAGGAGCCACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011972.1-2323s21c1
Sequence:CCGGATCCGATGTAAGATGTAATAGCTCGAGCTATTACATCTTACATCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011972.1-809s21c1
Sequence:CCGGATTCCTGGTATCGGCTATAAACTCGAGTTTATAGCCGATACCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011972.1-1001s21c1
Sequence:CCGGAGTGAAGAAGATACGTTTAAACTCGAGTTTAAACGTATCTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011972.1-1611s21c1
Sequence:CCGGAGCAACTTCCAGCAGATATTCCTCGAGGAATATCTGCTGGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011972.1-2284s1c1
Sequence:CCGGCCAGGGCATAACCAAATAGAACTCGAGTTCTATTTGGTTATGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011972.1-1043s1c1
Sequence:CCGGGCTAAAGCTAAGATTGAAGAACTCGAGTTCTTCAATCTTAGCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011972.1-692s1c1
Sequence:CCGGGCTCCTAATAAACTCTTGGCACTCGAGTGCCAAGAGTTTATTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011972
VALIDATED
POLI MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed) iota
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011972.1-683s21c1
Sequence:CCGGGCCGGAGTGGCTCCTAATAAACTCGAGTTTATTAGGAGCCACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011972.1-2323s21c1
Sequence:CCGGATCCGATGTAAGATGTAATAGCTCGAGCTATTACATCTTACATCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011972.1-809s21c1
Sequence:CCGGATTCCTGGTATCGGCTATAAACTCGAGTTTATAGCCGATACCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011972.1-1001s21c1
Sequence:CCGGAGTGAAGAAGATACGTTTAAACTCGAGTTTAAACGTATCTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011972.1-1611s21c1
Sequence:CCGGAGCAACTTCCAGCAGATATTCCTCGAGGAATATCTGCTGGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011972.1-2284s1c1
Sequence:CCGGCCAGGGCATAACCAAATAGAACTCGAGTTCTATTTGGTTATGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011972.1-1043s1c1
Sequence:CCGGGCTAAAGCTAAGATTGAAGAACTCGAGTTCTTCAATCTTAGCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011972.1-692s1c1
Sequence:CCGGGCTCCTAATAAACTCTTGGCACTCGAGTGCCAAGAGTTTATTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks