EMAIL THIS PAGE TO A FRIEND

POLR3K

polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa

Synonyms: C11 C11-RNP3 RPC10 RPC11 RPC12.5 hRPC11
UniProtKB ID: Q9Y2Y1, Q1W6H4, Q96S35
Gene ID:
Human(51728) Summary: This gene encodes a small essential subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The carboxy-terminal domain of this subunit shares a high degree of sequence similarity to the carboxy-terminal domain of an RNA polymerase II elongation factor. This similarity in sequence is supported by functional studies showing that this subunit is required for proper pausing and termination during transcription. Pseudogenes of this gene are found on chromosomes 13 and 17.[provided by RefSeq, Jul 2010]
Mouse(67005) polymerase (RNA) III (DNA directed) polypeptide K
Rat(366277) polymerase (RNA) III (DNA directed) polypeptide K
cow(618296) polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
Goat(100861345) polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
sheep(101107752) polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
naked mole-rat(101710961) polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
Domestic Rabbit(100328798) polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
domestic guinea pig(100735417) polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
Zebrafish(436826) polymerase (RNA) III (DNA directed) polypeptide K
chicken(768505) polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
dog(611625) polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
domestic cat(101090479) polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025901 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025901 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025901 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016310 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016310 Rosetta Predictions human pricing
NM_001014259 Rosetta Predictions rat pricing
NM_025901 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072550 predicted 264
2 SASI_Hs01_00072551 predicted 461
3 SASI_Hs01_00072552 predicted 300
4 SASI_Hs02_00349243 predicted 445
5 SASI_Hs01_00072553 predicted 250
6 SASI_Hs01_00072555 predicted 235
7 SASI_Hs01_00072556 predicted 220
8 SASI_Hs01_00072558 predicted 293
9 SASI_Hs01_00072559 predicted 461
10 SASI_Hs02_00349244 predicted 498
11 SASI_Hs01_00072554 predicted 214
12 SASI_Hs01_00072557 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098199 predicted 326
2 SASI_Rn01_00098200 predicted 242
3 SASI_Rn01_00098201 predicted 307
4 SASI_Rn01_00098202 predicted 320
5 SASI_Rn01_00098203 predicted 239
6 SASI_Rn01_00098204 predicted 278
7 SASI_Rn01_00098205 predicted 287
8 SASI_Rn01_00098206 predicted 368
9 SASI_Rn01_00098207 predicted 343
10 SASI_Rn01_00098208 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128886 predicted 361
2 SASI_Mm01_00128890 predicted 506
3 SASI_Mm02_00329251 predicted 415
4 SASI_Mm01_00128892 predicted 323
5 SASI_Mm02_00329252 predicted 216
6 SASI_Mm01_00128893 predicted 538
7 SASI_Mm02_00329253 predicted 590
8 SASI_Mm01_00128895 predicted 517
9 SASI_Mm02_00329254 predicted 544
10 SASI_Mm02_00329255 predicted 463
11 SASI_Mm01_00128887 predicted 855
12 SASI_Mm01_00128888 predicted 297
13 SASI_Mm01_00128889 predicted 438
14 SASI_Mm01_00128891 predicted 232
15 SASI_Mm01_00128894 predicted 763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025901
POLR3K MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025901.3-337s21c1
Sequence:CCGGATGCAGCTTCAGACGCGTTCTCTCGAGAGAACGCGTCTGAAGCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025901.3-161s21c1
Sequence:CCGGATCGCTTCGCCTGCAACACTTCTCGAGAAGTGTTGCAGGCGAAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025901.2-2137s1c1
Sequence:CCGGGCTGTAGTATAGGGATAGAATCTCGAGATTCTATCCCTATACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025901.2-390s1c1
Sequence:CCGGCCACCTTCTATAAGTGCTGCACTCGAGTGCAGCACTTATAGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025901.2-205s1c1
Sequence:CCGGCGTCCATAATATCACCCGTAACTCGAGTTACGGGTGATATTATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025901.2-220s1c1
Sequence:CCGGCCGTAAGGTAACAAACCGAAACTCGAGTTTCGGTTTGTTACCTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025901.2-392s1c1
Sequence:CCGGACCTTCTATAAGTGCTGCAATCTCGAGATTGCAGCACTTATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025901
POLR3K MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025901.3-337s21c1
Sequence:CCGGATGCAGCTTCAGACGCGTTCTCTCGAGAGAACGCGTCTGAAGCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025901.3-161s21c1
Sequence:CCGGATCGCTTCGCCTGCAACACTTCTCGAGAAGTGTTGCAGGCGAAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025901.2-2137s1c1
Sequence:CCGGGCTGTAGTATAGGGATAGAATCTCGAGATTCTATCCCTATACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025901.2-390s1c1
Sequence:CCGGCCACCTTCTATAAGTGCTGCACTCGAGTGCAGCACTTATAGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025901.2-205s1c1
Sequence:CCGGCGTCCATAATATCACCCGTAACTCGAGTTACGGGTGATATTATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025901.2-220s1c1
Sequence:CCGGCCGTAAGGTAACAAACCGAAACTCGAGTTTCGGTTTGTTACCTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025901.2-392s1c1
Sequence:CCGGACCTTCTATAAGTGCTGCAATCTCGAGATTGCAGCACTTATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025901
POLR3K MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025901.3-337s21c1
Sequence:CCGGATGCAGCTTCAGACGCGTTCTCTCGAGAGAACGCGTCTGAAGCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025901.3-161s21c1
Sequence:CCGGATCGCTTCGCCTGCAACACTTCTCGAGAAGTGTTGCAGGCGAAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025901.2-2137s1c1
Sequence:CCGGGCTGTAGTATAGGGATAGAATCTCGAGATTCTATCCCTATACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025901.2-390s1c1
Sequence:CCGGCCACCTTCTATAAGTGCTGCACTCGAGTGCAGCACTTATAGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025901.2-205s1c1
Sequence:CCGGCGTCCATAATATCACCCGTAACTCGAGTTACGGGTGATATTATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025901.2-220s1c1
Sequence:CCGGCCGTAAGGTAACAAACCGAAACTCGAGTTTCGGTTTGTTACCTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025901.2-392s1c1
Sequence:CCGGACCTTCTATAAGTGCTGCAATCTCGAGATTGCAGCACTTATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016310
VALIDATED
POLR3K MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016310.2-584s21c1
Sequence:CCGGAGACAGAGACCCATAACTAAACTCGAGTTTAGTTATGGGTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016310.2-306s21c1
Sequence:CCGGGCCGATGACCACCTTCTACAACTCGAGTTGTAGAAGGTGGTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016310.2-255s21c1
Sequence:CCGGCGAACATCCTCGTGCTTACTTCTCGAGAAGTAAGCACGAGGATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016310.2-181s21c1
Sequence:CCGGGAAGTGGATGATGTGCTTGGTCTCGAGACCAAGCACATCATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016310.2-212s1c1
Sequence:CCGGCCTGGGAGAATGTTGACTCTACTCGAGTAGAGTCAACATTCTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016310.2-306s1c1
Sequence:CCGGGCCGATGACCACCTTCTACAACTCGAGTTGTAGAAGGTGGTCATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016310.2-255s1c1
Sequence:CCGGCGAACATCCTCGTGCTTACTTCTCGAGAAGTAAGCACGAGGATGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016310.2-181s1c1
Sequence:CCGGGAAGTGGATGATGTGCTTGGTCTCGAGACCAAGCACATCATCCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016310.2-144s1c1
Sequence:CCGGCCGCAAGGTAACAAATCGGAACTCGAGTTCCGATTTGTTACCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016310
VALIDATED
POLR3K MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016310.2-584s21c1
Sequence:CCGGAGACAGAGACCCATAACTAAACTCGAGTTTAGTTATGGGTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016310.2-306s21c1
Sequence:CCGGGCCGATGACCACCTTCTACAACTCGAGTTGTAGAAGGTGGTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016310.2-255s21c1
Sequence:CCGGCGAACATCCTCGTGCTTACTTCTCGAGAAGTAAGCACGAGGATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016310.2-181s21c1
Sequence:CCGGGAAGTGGATGATGTGCTTGGTCTCGAGACCAAGCACATCATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016310.2-212s1c1
Sequence:CCGGCCTGGGAGAATGTTGACTCTACTCGAGTAGAGTCAACATTCTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016310.2-306s1c1
Sequence:CCGGGCCGATGACCACCTTCTACAACTCGAGTTGTAGAAGGTGGTCATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016310.2-255s1c1
Sequence:CCGGCGAACATCCTCGTGCTTACTTCTCGAGAAGTAAGCACGAGGATGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016310.2-181s1c1
Sequence:CCGGGAAGTGGATGATGTGCTTGGTCTCGAGACCAAGCACATCATCCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016310.2-144s1c1
Sequence:CCGGCCGCAAGGTAACAAATCGGAACTCGAGTTCCGATTTGTTACCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016310
VALIDATED
POLR3K MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016310.2-584s21c1
Sequence:CCGGAGACAGAGACCCATAACTAAACTCGAGTTTAGTTATGGGTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016310.2-306s21c1
Sequence:CCGGGCCGATGACCACCTTCTACAACTCGAGTTGTAGAAGGTGGTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016310.2-255s21c1
Sequence:CCGGCGAACATCCTCGTGCTTACTTCTCGAGAAGTAAGCACGAGGATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016310.2-181s21c1
Sequence:CCGGGAAGTGGATGATGTGCTTGGTCTCGAGACCAAGCACATCATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016310.2-212s1c1
Sequence:CCGGCCTGGGAGAATGTTGACTCTACTCGAGTAGAGTCAACATTCTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016310.2-306s1c1
Sequence:CCGGGCCGATGACCACCTTCTACAACTCGAGTTGTAGAAGGTGGTCATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016310.2-255s1c1
Sequence:CCGGCGAACATCCTCGTGCTTACTTCTCGAGAAGTAAGCACGAGGATGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016310.2-181s1c1
Sequence:CCGGGAAGTGGATGATGTGCTTGGTCTCGAGACCAAGCACATCATCCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016310.2-144s1c1
Sequence:CCGGCCGCAAGGTAACAAATCGGAACTCGAGTTCCGATTTGTTACCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks