EMAIL THIS PAGE TO A FRIEND

POMC

proopiomelanocortin

Synonyms: ACTH CLIP LPH MSH NPP POC
UniProtKB ID: P01189, P78442, Q53T23, Q9UD39, Q9UD40
Gene ID:
Human(5443) Summary: This gene encodes a polypeptide hormone precursor that undergoes extensive, tissue-specific, post-translational processing via cleavage by subtilisin-like enzymes known as prohormone convertases. There are eight potential cleavage sites within the polypeptide precursor and, depending on tissue type and the available convertases, processing may yield as many as ten biologically active peptides involved in diverse cellular functions. The encoded protein is synthesized mainly in corticotroph cells of the anterior pituitary where four cleavage sites are used; adrenocorticotrophin, essential for normal steroidogenesis and the maintenance of normal adrenal weight, and lipotropin beta are the major end products. In other tissues, including the hypothalamus, placenta, and epithelium, all cleavage sites may be used, giving rise to peptides with roles in pain and energy homeostasis, melanocyte stimulation, and immune modulation. These include several distinct melanotropins, lipotropins, and endorphins that are contained within the adrenocorticotrophin and beta-lipotropin peptides. Mutations in this gene have been associated with early onset obesity, adrenal insufficiency, and red hair pigmentation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
Mouse(18976) pro-opiomelanocortin-alpha
Rat(24664) proopiomelanocortin
chicken(422011) proopiomelanocortin
dog(403659) proopiomelanocortin
domestic cat(101087223) proopiomelanocortin
Horse(100071524) proopiomelanocortin
cow(281416) proopiomelanocortin
Goat(100861398) proopiomelanocortin
sheep(443212) proopiomelanocortin
naked mole-rat(101718053) proopiomelanocortin
domestic guinea pig(100720803) proopiomelanocortin
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M0939 Anti-α-MSH antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
microarray, radioimmunoassay pricing
SAB1305593 ANTI-PHOSPHO-ACTH(S168) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
GW21445 Anti-POMC antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunocytochemistry, western blot pricing
SAB1406272 Anti-POMC antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1409457 Anti-POMC antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1410992 Anti-POMC antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA046135 Anti-POMC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing
HPA063644 Anti-POMC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing
SAB2500826 Anti-Proopiomelanocortin/POMC antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
WH0005443M1 Monoclonal Anti-POMC antibody produced in mouse clone 3E11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Proteins

Product # Description Species Add to Cart
 
E0637 β-Endorphin bovine, camel, ovine ≥97% (HPLC) cow pricing
E6136 α-Endorphin human ≥97% (HPLC) human pricing
M4135 α-Melanocyte stimulating hormone ≥97% (HPLC) human pricing
M4603 Acetyl-[Nle4, Asp5, D-2-Nal7, Lys10]-cyclo-α-Melanocyte Stimulating Hormone Amide Fragment 4-10 ≥95% (HPLC) human pricing
A2227 Adrenocorticoptropic Hormone Fragment 22 - 39 ≥95% (HPLC) human pricing
A2407 Adrenocorticotropic Hormone Fragment 1-17 human, rat ≥97% (HPLC) human pricing
A0298 Adrenocorticotropic Hormone Fragment 1-24 human, rat ≥97% (HPLC) human pricing
A0673 Adrenocorticotropic Hormone Fragment 18-39 human ≥97% (HPLC) human pricing
A1527 Adrenocorticotropic Hormone Fragment 7-38 human ≥97% (HPLC) human pricing
A0423 Adrenocorticotropic Hormone human ≥97% (HPLC) human pricing
E6261 β-Endorphin human ≥95% (HPLC) human pricing
E6636 β-Endorphin human fragment 1-27 ≥97% (HPLC) human pricing
M6513 β-Melanocyte Stimulating Hormone human ≥95% (HPLC) human pricing
C0668 Cys-Asp-Pro-Gly-Tyr-Ile-Gly-Ser-Arg ≥90% (HPLC) human pricing
A3597 [D-Lys16]-Adrenocorticotropic Hormone Fragment 1-24 human, rat trifluoroacetate salt ≥95% (HPLC), solid human pricing
M8267 des-Ac-α-Melanocyte Stimulating Hormone ≥97% (HPLC) human pricing
E3005 des-Tyr1-γ-Endorphin ≥97% (HPLC) human pricing
M7896 Diacetyl-α-Melanocyte Stimulating Hormone ≥97% (HPLC) human pricing
M9638 γ-Melanocyte Stimulating Hormone ≥97% (HPLC) human pricing
M7907 N-Acetyl-[Cys4,10, D-Phe7]-α-Melanocyte Stimulating Hormone Fragment 4-13 ≥95% (HPLC) human pricing
M8764 [Nle4, D-Phe7]-α-Melanocyte Stimulating Hormone trifluoroacetate salt ≥95% (HPLC) human pricing
APREST91052 PrEST Antigen POMC Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution New human pricing
APREST92385 PrEST Antigen POMC Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution New human pricing
QPREST22476 SILuPrEST COLI SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
A1709 Adrenocorticotropic Hormone Fragment 1-10 human, rat ≥97% (HPLC) human, rat pricing
A0401 Adrenocorticotropic Hormone Fragment 4-10 human, rat ≥97% (HPLC) human, rat pricing
M2910 [D-Trp7, Ala8, D-Phe10]-α-Melanocyte Stimulating Hormone Amide Fragment 6-11 ≥97% (HPLC) human, rat pricing
A7075 Adrenocorticotropic Hormone rat ≥95% (HPLC) rat pricing
E1142 β-Endorphin rat ≥97% (HPLC) rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000939 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000939 Rosetta Predictions human pricing
NM_001035256 Rosetta Predictions human pricing
NM_139326 Rosetta Predictions rat pricing
NM_008895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073421 predicted 921
2 SASI_Hs01_00073422 predicted 920
3 SASI_Hs01_00073423 predicted 908
4 SASI_Hs01_00073424 predicted 909
5 SASI_Hs01_00073425 predicted 828
6 SASI_Hs01_00073426 predicted 756
7 SASI_Hs01_00073428 predicted 893
8 SASI_Hs01_00073429 predicted 924
9 SASI_Hs01_00073430 predicted 836
10 SASI_Hs02_00303544 predicted 751
11 SASI_Hs01_00073427 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013132 predicted 968
2 SASI_Hs01_00013133 predicted 973
3 SASI_Hs01_00013134 predicted 960
4 SASI_Hs01_00013135 predicted 968
5 SASI_Hs01_00013136 predicted 880
6 SASI_Hs01_00013137 predicted 811
7 SASI_Hs01_00013139 predicted 946
8 SASI_Hs01_00013140 predicted 973
9 SASI_Hs01_00013141 predicted 892
10 SASI_Hs02_00308179 predicted 800
11 SASI_Hs01_00013138 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268566 predicted 251
2 SASI_Rn02_00268567 predicted 615
3 SASI_Rn01_00094431 predicted 223
4 SASI_Rn01_00094432 predicted 294
5 SASI_Rn01_00094434 predicted 266
6 SASI_Rn01_00094436 predicted 389
7 SASI_Rn01_00094437 predicted 317
8 SASI_Rn01_00094438 predicted 625
9 SASI_Rn02_00268568 predicted 304
10 SASI_Rn01_00094439 predicted 657
11 SASI_Rn01_00094430 predicted 682
12 SASI_Rn01_00094433 predicted 316
13 SASI_Rn01_00094435 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314908 predicted 635
2 SASI_Mm01_00039139 predicted 318
3 SASI_Mm01_00039141 predicted 316
4 SASI_Mm01_00039142 predicted 278
5 SASI_Mm01_00039145 predicted 308
6 SASI_Mm01_00039146 predicted 518
7 SASI_Mm02_00314909 predicted 294
8 SASI_Mm02_00314910 predicted 282
9 SASI_Mm01_00039138 predicted 761
10 SASI_Mm01_00039140 predicted 750
11 SASI_Mm01_00039143 predicted 203
12 SASI_Mm01_00039144 predicted 772
13 SASI_Mm01_00039147 predicted 763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000939
POMC MISSION shRNA Bacterial Glycerol Stock
proopiomelanocortin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-820s1c1
Sequence:CCGGCGGTTTCATGACCTCCGAGAACTCGAGTTCTCGGAGGTCATGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-876s1c1
Sequence:CCGGCCATCATCAAGAACGCCTACACTCGAGTGTAGGCGTTCTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-217s1c1
Sequence:CCGGCACCACGGAAAGCAACCTGCTCTCGAGAGCAGGTTGCTTTCCGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-331s1c1
Sequence:CCGGGAAGTACGTCATGGGCCACTTCTCGAGAAGTGGCCCATGACGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-277s1c1
Sequence:CCGGGACTCCCATGTTCCCGGGAAACTCGAGTTTCCCGGGAACATGGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000939.2-385s21c1
Sequence:CCGGACTCCCATGTTCCCGGGAAATCTCGAGATTTCCCGGGAACATGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000939.2-679s21c1
Sequence:CCGGCCAGTGAAGGTGTACCCTAACCTCGAGGTTAGGGTACACCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000939.2-624s21c1
Sequence:CCGGCTCCTACTCCATGGAGCACTTCTCGAGAAGTGCTCCATGGAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000939.2-984s21c1
Sequence:CCGGCATCATCAAGAACGCCTACAACTCGAGTTGTAGGCGTTCTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000939
POMC MISSION shRNA shRNA Plasmid DNA
proopiomelanocortin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-820s1c1
Sequence:CCGGCGGTTTCATGACCTCCGAGAACTCGAGTTCTCGGAGGTCATGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-876s1c1
Sequence:CCGGCCATCATCAAGAACGCCTACACTCGAGTGTAGGCGTTCTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-217s1c1
Sequence:CCGGCACCACGGAAAGCAACCTGCTCTCGAGAGCAGGTTGCTTTCCGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-331s1c1
Sequence:CCGGGAAGTACGTCATGGGCCACTTCTCGAGAAGTGGCCCATGACGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-277s1c1
Sequence:CCGGGACTCCCATGTTCCCGGGAAACTCGAGTTTCCCGGGAACATGGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000939.2-385s21c1
Sequence:CCGGACTCCCATGTTCCCGGGAAATCTCGAGATTTCCCGGGAACATGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000939.2-679s21c1
Sequence:CCGGCCAGTGAAGGTGTACCCTAACCTCGAGGTTAGGGTACACCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000939.2-624s21c1
Sequence:CCGGCTCCTACTCCATGGAGCACTTCTCGAGAAGTGCTCCATGGAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000939.2-984s21c1
Sequence:CCGGCATCATCAAGAACGCCTACAACTCGAGTTGTAGGCGTTCTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000939
POMC MISSION shRNA Lentiviral Transduction Particles
proopiomelanocortin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-820s1c1
Sequence:CCGGCGGTTTCATGACCTCCGAGAACTCGAGTTCTCGGAGGTCATGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-876s1c1
Sequence:CCGGCCATCATCAAGAACGCCTACACTCGAGTGTAGGCGTTCTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-217s1c1
Sequence:CCGGCACCACGGAAAGCAACCTGCTCTCGAGAGCAGGTTGCTTTCCGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-331s1c1
Sequence:CCGGGAAGTACGTCATGGGCCACTTCTCGAGAAGTGGCCCATGACGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000939.1-277s1c1
Sequence:CCGGGACTCCCATGTTCCCGGGAAACTCGAGTTTCCCGGGAACATGGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000939.2-385s21c1
Sequence:CCGGACTCCCATGTTCCCGGGAAATCTCGAGATTTCCCGGGAACATGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000939.2-679s21c1
Sequence:CCGGCCAGTGAAGGTGTACCCTAACCTCGAGGTTAGGGTACACCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000939.2-624s21c1
Sequence:CCGGCTCCTACTCCATGGAGCACTTCTCGAGAAGTGCTCCATGGAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000939.2-984s21c1
Sequence:CCGGCATCATCAAGAACGCCTACAACTCGAGTTGTAGGCGTTCTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008895
POMC MISSION shRNA Bacterial Glycerol Stock
proopiomelanocortin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-628s1c1
Sequence:CCGGCCTAGAGTTCAAGAGGGAGCTCTCGAGAGCTCCCTCTTGAACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-200s1c1
Sequence:CCGGCTGCTTCAGACCTCCATAGATCTCGAGATCTATGGAGGTCTGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-814s1c1
Sequence:CCGGCTTCAAGAACGCCATCATCAACTCGAGTTGATGATGGCGTTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-376s1c1
Sequence:CCGGGAAGTACGTCATGGGTCACTTCTCGAGAAGTGACCCATGACGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-826s1c1
Sequence:CCGGCATCATCAAGAACGCGCACAACTCGAGTTGTGCGCGTTCTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008895
POMC MISSION shRNA shRNA Plasmid DNA
proopiomelanocortin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-628s1c1
Sequence:CCGGCCTAGAGTTCAAGAGGGAGCTCTCGAGAGCTCCCTCTTGAACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-200s1c1
Sequence:CCGGCTGCTTCAGACCTCCATAGATCTCGAGATCTATGGAGGTCTGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-814s1c1
Sequence:CCGGCTTCAAGAACGCCATCATCAACTCGAGTTGATGATGGCGTTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-376s1c1
Sequence:CCGGGAAGTACGTCATGGGTCACTTCTCGAGAAGTGACCCATGACGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-826s1c1
Sequence:CCGGCATCATCAAGAACGCGCACAACTCGAGTTGTGCGCGTTCTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008895
POMC MISSION shRNA Lentiviral Transduction Particles
proopiomelanocortin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-628s1c1
Sequence:CCGGCCTAGAGTTCAAGAGGGAGCTCTCGAGAGCTCCCTCTTGAACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-200s1c1
Sequence:CCGGCTGCTTCAGACCTCCATAGATCTCGAGATCTATGGAGGTCTGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-814s1c1
Sequence:CCGGCTTCAAGAACGCCATCATCAACTCGAGTTGATGATGGCGTTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-376s1c1
Sequence:CCGGGAAGTACGTCATGGGTCACTTCTCGAGAAGTGACCCATGACGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008895.2-826s1c1
Sequence:CCGGCATCATCAAGAACGCGCACAACTCGAGTTGTGCGCGTTCTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks