EMAIL THIS PAGE TO A FRIEND

POMK

protein-O-mannose kinase

Synonyms: MDDGA12 SGK196
Species: Human POMK(84197), Mouse Pomk(74653), Zebrafish pomk(492773)
Gene ID:
Human(84197) Summary: This gene encodes a protein that may be involved in the presentation of the laminin-binding O-linked carbohydrate chain of alpha-dystroglycan (a-DG), which forms transmembrane linkages between the extracellular matrix and the exoskeleton. Some pathogens use this O-linked carbohydrate unit for host entry. Loss of function compound heterozygous mutations in this gene were found in a human patient affected by the Walker-Warburg syndrome (WWS) phenotype. Mice lacking this gene contain misplaced neurons (heterotopia) in some regions of the brain, possibly from defects in neuronal migration. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(74653) protein-O-mannose kinase
Zebrafish(492773) protein-O-mannose kinase
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029037 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029037 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029037 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032237 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU009901 MISSION® esiRNA esiRNA targeting mouse 4930444A02Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032237 Rosetta Predictions human pricing
NM_029037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139832 predicted 801
2 SASI_Hs01_00139833 predicted 424
3 SASI_Hs01_00139834 predicted 732
4 SASI_Hs01_00139835 predicted 1128
5 SASI_Hs01_00139836 predicted 1069
6 SASI_Hs02_00359547 predicted 1145
7 SASI_Hs01_00139837 predicted 646
8 SASI_Hs01_00139838 predicted 679
9 SASI_Hs02_00359548 predicted 893
10 SASI_Hs01_00139839 predicted 926
11 SASI_Hs01_00139840 predicted 562
12 SASI_Hs01_00139841 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049880 predicted 757
2 SASI_Mm01_00049881 predicted 1168
3 SASI_Mm01_00049882 predicted 763
4 SASI_Mm01_00049883 predicted 784
5 SASI_Mm01_00049884 predicted 704
6 SASI_Mm01_00049885 predicted 923
7 SASI_Mm01_00049886 predicted 1097
8 SASI_Mm02_00334777 predicted 1084
9 SASI_Mm01_00049887 predicted 296
10 SASI_Mm01_00049888 predicted 1279
11 SASI_Mm01_00049889 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029037
VALIDATED
POMK MISSION shRNA Bacterial Glycerol Stock
protein-O-mannose kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029037.4-1310s21c1
Sequence:CCGGGCAGACGAAAGAAATGCTGTACTCGAGTACAGCATTTCTTTCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029037.4-1169s21c1
Sequence:CCGGAGGGAGTGATATGGTTAGATTCTCGAGAATCTAACCATATCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029037.4-757s21c1
Sequence:CCGGTGGAAGAAACACTAAACCTTTCTCGAGAAAGGTTTAGTGTTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029037.4-708s21c1
Sequence:CCGGGATGGCACTATTCTCACCGAACTCGAGTTCGGTGAGAATAGTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029037.4-926s21c1
Sequence:CCGGGCTAACAAGTAACTTCAGCATCTCGAGATGCTGAAGTTACTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-758s1c1
Sequence:CCGGTGGAAGAAACACTAAACCTTTCTCGAGAAAGGTTTAGTGTTTCTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-927s1c1
Sequence:CCGGGCTAACAAGTAACTTCAGCATCTCGAGATGCTGAAGTTACTTGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-1311s1c1
Sequence:CCGGGCAGACGAAAGAAATGCTGTACTCGAGTACAGCATTTCTTTCGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-709s1c1
Sequence:CCGGGATGGCACTATTCTCACCGAACTCGAGTTCGGTGAGAATAGTGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-1170s1c1
Sequence:CCGGAGGGAGTGATATGGTTAGATTCTCGAGAATCTAACCATATCACTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029037
VALIDATED
POMK MISSION shRNA shRNA Plasmid DNA
protein-O-mannose kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029037.4-1310s21c1
Sequence:CCGGGCAGACGAAAGAAATGCTGTACTCGAGTACAGCATTTCTTTCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029037.4-1169s21c1
Sequence:CCGGAGGGAGTGATATGGTTAGATTCTCGAGAATCTAACCATATCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029037.4-757s21c1
Sequence:CCGGTGGAAGAAACACTAAACCTTTCTCGAGAAAGGTTTAGTGTTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029037.4-708s21c1
Sequence:CCGGGATGGCACTATTCTCACCGAACTCGAGTTCGGTGAGAATAGTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029037.4-926s21c1
Sequence:CCGGGCTAACAAGTAACTTCAGCATCTCGAGATGCTGAAGTTACTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-758s1c1
Sequence:CCGGTGGAAGAAACACTAAACCTTTCTCGAGAAAGGTTTAGTGTTTCTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-927s1c1
Sequence:CCGGGCTAACAAGTAACTTCAGCATCTCGAGATGCTGAAGTTACTTGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-1311s1c1
Sequence:CCGGGCAGACGAAAGAAATGCTGTACTCGAGTACAGCATTTCTTTCGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-709s1c1
Sequence:CCGGGATGGCACTATTCTCACCGAACTCGAGTTCGGTGAGAATAGTGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-1170s1c1
Sequence:CCGGAGGGAGTGATATGGTTAGATTCTCGAGAATCTAACCATATCACTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029037
VALIDATED
POMK MISSION shRNA Lentiviral Transduction Particles
protein-O-mannose kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029037.4-1310s21c1
Sequence:CCGGGCAGACGAAAGAAATGCTGTACTCGAGTACAGCATTTCTTTCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029037.4-1169s21c1
Sequence:CCGGAGGGAGTGATATGGTTAGATTCTCGAGAATCTAACCATATCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029037.4-757s21c1
Sequence:CCGGTGGAAGAAACACTAAACCTTTCTCGAGAAAGGTTTAGTGTTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029037.4-708s21c1
Sequence:CCGGGATGGCACTATTCTCACCGAACTCGAGTTCGGTGAGAATAGTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029037.4-926s21c1
Sequence:CCGGGCTAACAAGTAACTTCAGCATCTCGAGATGCTGAAGTTACTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-758s1c1
Sequence:CCGGTGGAAGAAACACTAAACCTTTCTCGAGAAAGGTTTAGTGTTTCTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-927s1c1
Sequence:CCGGGCTAACAAGTAACTTCAGCATCTCGAGATGCTGAAGTTACTTGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-1311s1c1
Sequence:CCGGGCAGACGAAAGAAATGCTGTACTCGAGTACAGCATTTCTTTCGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-709s1c1
Sequence:CCGGGATGGCACTATTCTCACCGAACTCGAGTTCGGTGAGAATAGTGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029037.2-1170s1c1
Sequence:CCGGAGGGAGTGATATGGTTAGATTCTCGAGAATCTAACCATATCACTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032237
POMK MISSION shRNA Bacterial Glycerol Stock
protein-O-mannose kinase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032237.x-1338s1c1
Sequence:CCGGGAAGGGCTGAATGGAAGTTACCTCGAGGTAACTTCCATTCAGCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032237.x-1159s1c1
Sequence:CCGGGTCCGATTCCATTTGTTTGATCTCGAGATCAAACAAATGGAATCGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032237.x-589s1c1
Sequence:CCGGAGCCTGGAGATGAAAGATGATCTCGAGATCATCTTTCATCTCCAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032237.x-685s1c1
Sequence:CCGGGACAACACTATGCTTACTGAACTCGAGTTCAGTAAGCATAGTGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032237.x-339s1c1
Sequence:CCGGCCTGATGAATACTCTACTCTACTCGAGTAGAGTAGAGTATTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032237.2-1354s1c1
Sequence:CCGGGTTACAGCATTCTACTCTGATCTCGAGATCAGAGTAGAATGCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032237.2-1346s1c1
Sequence:CCGGGAATGGAAGTTACAGCATTCTCTCGAGAGAATGCTGTAACTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032237.2-1063s1c1
Sequence:CCGGGATGATCTCATGCCCTCATATCTCGAGATATGAGGGCATGAGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195311    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032237.2-1422s1c1
Sequence:CCGGCTTAGCCATGTGGTTCGTTGTCTCGAGACAACGAACCACATGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032237
POMK MISSION shRNA shRNA Plasmid DNA
protein-O-mannose kinase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032237.x-1338s1c1
Sequence:CCGGGAAGGGCTGAATGGAAGTTACCTCGAGGTAACTTCCATTCAGCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032237.x-1159s1c1
Sequence:CCGGGTCCGATTCCATTTGTTTGATCTCGAGATCAAACAAATGGAATCGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032237.x-589s1c1
Sequence:CCGGAGCCTGGAGATGAAAGATGATCTCGAGATCATCTTTCATCTCCAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032237.x-685s1c1
Sequence:CCGGGACAACACTATGCTTACTGAACTCGAGTTCAGTAAGCATAGTGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032237.x-339s1c1
Sequence:CCGGCCTGATGAATACTCTACTCTACTCGAGTAGAGTAGAGTATTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032237.2-1354s1c1
Sequence:CCGGGTTACAGCATTCTACTCTGATCTCGAGATCAGAGTAGAATGCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032237.2-1346s1c1
Sequence:CCGGGAATGGAAGTTACAGCATTCTCTCGAGAGAATGCTGTAACTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032237.2-1063s1c1
Sequence:CCGGGATGATCTCATGCCCTCATATCTCGAGATATGAGGGCATGAGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195311    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032237.2-1422s1c1
Sequence:CCGGCTTAGCCATGTGGTTCGTTGTCTCGAGACAACGAACCACATGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032237
POMK MISSION shRNA Lentiviral Transduction Particles
protein-O-mannose kinase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032237.x-1338s1c1
Sequence:CCGGGAAGGGCTGAATGGAAGTTACCTCGAGGTAACTTCCATTCAGCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032237.x-1159s1c1
Sequence:CCGGGTCCGATTCCATTTGTTTGATCTCGAGATCAAACAAATGGAATCGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032237.x-589s1c1
Sequence:CCGGAGCCTGGAGATGAAAGATGATCTCGAGATCATCTTTCATCTCCAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032237.x-685s1c1
Sequence:CCGGGACAACACTATGCTTACTGAACTCGAGTTCAGTAAGCATAGTGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032237.x-339s1c1
Sequence:CCGGCCTGATGAATACTCTACTCTACTCGAGTAGAGTAGAGTATTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032237.2-1354s1c1
Sequence:CCGGGTTACAGCATTCTACTCTGATCTCGAGATCAGAGTAGAATGCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032237.2-1346s1c1
Sequence:CCGGGAATGGAAGTTACAGCATTCTCTCGAGAGAATGCTGTAACTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032237.2-1063s1c1
Sequence:CCGGGATGATCTCATGCCCTCATATCTCGAGATATGAGGGCATGAGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195311    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032237.2-1422s1c1
Sequence:CCGGCTTAGCCATGTGGTTCGTTGTCTCGAGACAACGAACCACATGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks