EMAIL THIS PAGE TO A FRIEND

POP1

processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)

UniProtKB ID: Q99575, A8K5W9, Q15037
Gene ID:
Human(10940) Summary: This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Mouse(67724) processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Rat(315045) processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
Thale Cress(834434) ABC transporter I family member 21
domestic cat(101094080) processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
Horse(100055680) processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
dog(481978) processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
chicken(425567) processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
cow(511306) processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
sheep(101106598) processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
Domestic Rabbit(100339220) processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
naked mole-rat(101713471) processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
domestic guinea pig(100714542) processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA060020 Anti-POP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015029 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026340 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026340 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026340 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015029 Rosetta Predictions human pricing
NM_001130550 Rosetta Predictions rat pricing
NM_026340 Rosetta Predictions mouse pricing
NM_152894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118516 predicted 1992
2 SASI_Hs01_00118517 predicted 2167
3 SASI_Hs01_00118519 predicted 1139
4 SASI_Hs01_00118520 predicted 1974
5 SASI_Hs02_00346830 predicted 941
6 SASI_Hs01_00118521 predicted 1273
7 SASI_Hs02_00346831 predicted 760
8 SASI_Hs01_00118524 predicted 930
9 SASI_Hs01_00118525 predicted 766
10 SASI_Hs02_00346832 predicted 1690
11 SASI_Hs01_00118518 predicted 365
12 SASI_Hs01_00118522 predicted 2059
13 SASI_Hs01_00118523 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255669 predicted 1944
2 SASI_Rn02_00255670 predicted 1579
3 SASI_Rn02_00255671 predicted 693
4 SASI_Rn02_00255672 predicted 2257
5 SASI_Rn02_00255673 predicted 1674
6 SASI_Rn02_00255674 predicted 282
7 SASI_Rn02_00255675 predicted 2473
8 SASI_Rn02_00255676 predicted 1565
9 SASI_Rn02_00255677 predicted 1272
10 SASI_Rn02_00255678 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155846 predicted 430
2 SASI_Mm01_00155847 predicted 2329
3 SASI_Mm01_00155848 predicted 878
4 SASI_Mm01_00155849 predicted 2917
5 SASI_Mm01_00155850 predicted 2262
6 SASI_Mm01_00155851 predicted 2168
7 SASI_Mm01_00155852 predicted 1264
8 SASI_Mm01_00155853 predicted 995
9 SASI_Mm01_00155854 predicted 459
10 SASI_Mm01_00155855 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170646 predicted 422
2 SASI_Mm01_00170647 predicted 2414
3 SASI_Mm01_00170648 predicted 871
4 SASI_Mm01_00170649 predicted 3000
5 SASI_Mm01_00170650 predicted 2341
6 SASI_Mm01_00170651 predicted 2256
7 SASI_Mm01_00170652 predicted 1252
8 SASI_Mm01_00170653 predicted 989
9 SASI_Mm01_00170654 predicted 454
10 SASI_Mm01_00170655 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015029
VALIDATED
POP1 MISSION shRNA Bacterial Glycerol Stock
processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015029.2-107s21c1
Sequence:CCGGGTGGCTGACAGAGGTGTAAAGCTCGAGCTTTACACCTCTGTCAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015029.2-1982s21c1
Sequence:CCGGCAGTATAAGAGGTCGCCTAATCTCGAGATTAGGCGACCTCTTATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015029.2-1272s21c1
Sequence:CCGGCTCCAACCACAGGCATTATAACTCGAGTTATAATGCCTGTGGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015029.2-3126s21c1
Sequence:CCGGGGCATAGATAATACGTTATTACTCGAGTAATAACGTATTATCTATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015029.2-1520s21c1
Sequence:CCGGGAAATTCCGGCAGGTACTATTCTCGAGAATAGTACCTGCCGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015029.2-3426s21c1
Sequence:CCGGAGGGCTTGTCAGGTCTATTTGCTCGAGCAAATAGACCTGACAAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015029.1-2922s1c1
Sequence:CCGGGCTTTGTGACTCAGGGAGATTCTCGAGAATCTCCCTGAGTCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015029.1-1350s1c1
Sequence:CCGGCCATCCTAACTGAAGCAATAACTCGAGTTATTGCTTCAGTTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015029.1-901s1c1
Sequence:CCGGCCTTGTGCTTTATCGGGTGAACTCGAGTTCACCCGATAAAGCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015029.1-2189s1c1
Sequence:CCGGGCTTACGAAGAACCTTCTGTACTCGAGTACAGAAGGTTCTTCGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015029.1-658s1c1
Sequence:CCGGGCGGTTTCATATGGTCAAGAACTCGAGTTCTTGACCATATGAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015029
VALIDATED
POP1 MISSION shRNA shRNA Plasmid DNA
processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015029.2-107s21c1
Sequence:CCGGGTGGCTGACAGAGGTGTAAAGCTCGAGCTTTACACCTCTGTCAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015029.2-1982s21c1
Sequence:CCGGCAGTATAAGAGGTCGCCTAATCTCGAGATTAGGCGACCTCTTATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015029.2-1272s21c1
Sequence:CCGGCTCCAACCACAGGCATTATAACTCGAGTTATAATGCCTGTGGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015029.2-3126s21c1
Sequence:CCGGGGCATAGATAATACGTTATTACTCGAGTAATAACGTATTATCTATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015029.2-1520s21c1
Sequence:CCGGGAAATTCCGGCAGGTACTATTCTCGAGAATAGTACCTGCCGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015029.2-3426s21c1
Sequence:CCGGAGGGCTTGTCAGGTCTATTTGCTCGAGCAAATAGACCTGACAAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015029.1-2922s1c1
Sequence:CCGGGCTTTGTGACTCAGGGAGATTCTCGAGAATCTCCCTGAGTCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015029.1-1350s1c1
Sequence:CCGGCCATCCTAACTGAAGCAATAACTCGAGTTATTGCTTCAGTTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015029.1-901s1c1
Sequence:CCGGCCTTGTGCTTTATCGGGTGAACTCGAGTTCACCCGATAAAGCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015029.1-2189s1c1
Sequence:CCGGGCTTACGAAGAACCTTCTGTACTCGAGTACAGAAGGTTCTTCGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015029.1-658s1c1
Sequence:CCGGGCGGTTTCATATGGTCAAGAACTCGAGTTCTTGACCATATGAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015029
VALIDATED
POP1 MISSION shRNA Lentiviral Transduction Particles
processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015029.2-107s21c1
Sequence:CCGGGTGGCTGACAGAGGTGTAAAGCTCGAGCTTTACACCTCTGTCAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015029.2-1982s21c1
Sequence:CCGGCAGTATAAGAGGTCGCCTAATCTCGAGATTAGGCGACCTCTTATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015029.2-1272s21c1
Sequence:CCGGCTCCAACCACAGGCATTATAACTCGAGTTATAATGCCTGTGGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015029.2-3126s21c1
Sequence:CCGGGGCATAGATAATACGTTATTACTCGAGTAATAACGTATTATCTATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015029.2-1520s21c1
Sequence:CCGGGAAATTCCGGCAGGTACTATTCTCGAGAATAGTACCTGCCGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015029.2-3426s21c1
Sequence:CCGGAGGGCTTGTCAGGTCTATTTGCTCGAGCAAATAGACCTGACAAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015029.1-2922s1c1
Sequence:CCGGGCTTTGTGACTCAGGGAGATTCTCGAGAATCTCCCTGAGTCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015029.1-1350s1c1
Sequence:CCGGCCATCCTAACTGAAGCAATAACTCGAGTTATTGCTTCAGTTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015029.1-901s1c1
Sequence:CCGGCCTTGTGCTTTATCGGGTGAACTCGAGTTCACCCGATAAAGCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015029.1-2189s1c1
Sequence:CCGGGCTTACGAAGAACCTTCTGTACTCGAGTACAGAAGGTTCTTCGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015029.1-658s1c1
Sequence:CCGGGCGGTTTCATATGGTCAAGAACTCGAGTTCTTGACCATATGAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026340
VALIDATED
POP1 MISSION shRNA Bacterial Glycerol Stock
processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026340.2-1585s1c1
Sequence:CCGGGAAATTCCAGCAGGTACTATTCTCGAGAATAGTACCTGCTGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026340.2-2338s1c1
Sequence:CCGGGAGATCTGCCAACTATCTAATCTCGAGATTAGATAGTTGGCAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-822s21c1
Sequence:CCGGCCTGCAGGATTTATCATATTACTCGAGTAATATGATAAATCCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-2253s21c1
Sequence:CCGGTGCCCAAGAGGCAGCTATTATCTCGAGATAATAGCTGCCTCTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-969s21c1
Sequence:CCGGCATGCTTTACCGGGCAAATAACTCGAGTTATTTGCCCGGTAAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-2338s21c1
Sequence:CCGGGAGATCTGCCAACTATCTAATCTCGAGATTAGATAGTTGGCAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-2007s21c1
Sequence:CCGGTGCACGAGTTGGTGGACTAAACTCGAGTTTAGTCCACCAACTCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026340.1-2111s1c1
Sequence:CCGGGCTGAAGATCAAGCTAAGGATCTCGAGATCCTTAGCTTGATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026340
VALIDATED
POP1 MISSION shRNA shRNA Plasmid DNA
processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026340.2-1585s1c1
Sequence:CCGGGAAATTCCAGCAGGTACTATTCTCGAGAATAGTACCTGCTGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026340.2-2338s1c1
Sequence:CCGGGAGATCTGCCAACTATCTAATCTCGAGATTAGATAGTTGGCAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-822s21c1
Sequence:CCGGCCTGCAGGATTTATCATATTACTCGAGTAATATGATAAATCCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-2253s21c1
Sequence:CCGGTGCCCAAGAGGCAGCTATTATCTCGAGATAATAGCTGCCTCTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-969s21c1
Sequence:CCGGCATGCTTTACCGGGCAAATAACTCGAGTTATTTGCCCGGTAAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-2338s21c1
Sequence:CCGGGAGATCTGCCAACTATCTAATCTCGAGATTAGATAGTTGGCAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-2007s21c1
Sequence:CCGGTGCACGAGTTGGTGGACTAAACTCGAGTTTAGTCCACCAACTCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026340.1-2111s1c1
Sequence:CCGGGCTGAAGATCAAGCTAAGGATCTCGAGATCCTTAGCTTGATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026340
VALIDATED
POP1 MISSION shRNA Lentiviral Transduction Particles
processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026340.2-1585s1c1
Sequence:CCGGGAAATTCCAGCAGGTACTATTCTCGAGAATAGTACCTGCTGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026340.2-2338s1c1
Sequence:CCGGGAGATCTGCCAACTATCTAATCTCGAGATTAGATAGTTGGCAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-822s21c1
Sequence:CCGGCCTGCAGGATTTATCATATTACTCGAGTAATATGATAAATCCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-2253s21c1
Sequence:CCGGTGCCCAAGAGGCAGCTATTATCTCGAGATAATAGCTGCCTCTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-969s21c1
Sequence:CCGGCATGCTTTACCGGGCAAATAACTCGAGTTATTTGCCCGGTAAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-2338s21c1
Sequence:CCGGGAGATCTGCCAACTATCTAATCTCGAGATTAGATAGTTGGCAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026340.2-2007s21c1
Sequence:CCGGTGCACGAGTTGGTGGACTAAACTCGAGTTTAGTCCACCAACTCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026340.1-2111s1c1
Sequence:CCGGGCTGAAGATCAAGCTAAGGATCTCGAGATCCTTAGCTTGATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks