EMAIL THIS PAGE TO A FRIEND

POPDC2

popeye domain containing 2

Synonyms: POP2
UniProtKB ID: Q9HBU9, Q86UE7
Gene ID:
Human(64091) Summary: This gene encodes a member of the POP family of proteins which contain three putative transmembrane domains. This membrane associated protein is predominantly expressed in skeletal and cardiac muscle, and may have an important function in these tissues. [provided by RefSeq, Jul 2008]
Mouse(64082) popeye domain containing 2
Rat(360718) popeye domain containing 2
cow(540535) popeye domain containing 2
sheep(101106898) popeye domain containing 2
naked mole-rat(101704845) popeye domain containing 2
domestic guinea pig(100713556) popeye domain containing 2
Zebrafish(793666) popeye domain containing 2
chicken(404229) popeye domain containing 2
domestic cat(101080567) popeye domain containing 2
Horse(100070977) popeye domain containing 2
dog(487996) popeye domain containing 2
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022135 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022318 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022318 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022318 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157241 MISSION® esiRNA esiRNA human POPDC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022135 Rosetta Predictions human pricing
NM_199113 Rosetta Predictions rat pricing
NM_001081984 Rosetta Predictions mouse pricing
NM_022318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088294 predicted 1134
2 SASI_Hs01_00088296 predicted 974
3 SASI_Hs01_00088298 predicted 742
4 SASI_Hs01_00088299 predicted 267
5 SASI_Hs01_00088300 predicted 681
6 SASI_Hs01_00088301 predicted 854
7 SASI_Hs02_00355543 predicted 805
8 SASI_Hs01_00088302 predicted 872
9 SASI_Hs02_00355544 predicted 445
10 SASI_Hs02_00355545 predicted 1122
11 SASI_Hs01_00088295 predicted 507
12 SASI_Hs01_00088297 predicted 571
13 SASI_Hs01_00088303 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112142 predicted 1939
2 SASI_Rn01_00112144 predicted 1773
3 SASI_Rn01_00112146 predicted 1182
4 SASI_Rn01_00112147 predicted 1035
5 SASI_Rn01_00112148 predicted 1898
6 SASI_Rn01_00112149 predicted 1485
7 SASI_Rn02_00270136 predicted 1157
8 SASI_Rn01_00112150 predicted 793
9 SASI_Rn01_00112151 predicted 1171
10 SASI_Rn02_00270137 predicted 1731
11 SASI_Rn01_00112143 predicted 1139
12 SASI_Rn01_00112145 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299222 predicted 1978
2 SASI_Mm02_00299223 predicted 581
3 SASI_Mm02_00299224 predicted 619
4 SASI_Mm02_00299225 predicted 1935
5 SASI_Mm02_00299226 predicted 543
6 SASI_Mm02_00299227 predicted 612
7 SASI_Mm02_00299228 predicted 1240
8 SASI_Mm02_00299229 predicted 1188
9 SASI_Mm02_00299230 predicted 780
10 SASI_Mm02_00299231 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326546 predicted 1803
2 SASI_Mm02_00326547 predicted 538
3 SASI_Mm01_00153279 predicted 583
4 SASI_Mm02_00326548 predicted 1755
5 SASI_Mm01_00153280 predicted 498
6 SASI_Mm01_00153281 predicted 581
7 SASI_Mm01_00153283 predicted 1207
8 SASI_Mm01_00153284 predicted 1157
9 SASI_Mm02_00326549 predicted 745
10 SASI_Mm01_00153285 predicted 1177
11 SASI_Mm01_00153282 predicted 614
12 SASI_Mm01_00153286 predicted 1092
13 SASI_Mm01_00153287 predicted 1171
14 SASI_Mm01_00153288 predicted 978
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022135
POPDC2 MISSION shRNA Bacterial Glycerol Stock
popeye domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022135.2-1161s1c1
Sequence:CCGGCAGAGCTACTCTCAAGTTATACTCGAGTATAACTTGAGAGTAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022135.2-1386s1c1
Sequence:CCGGCCTGAAGTGACTTTGAGAAATCTCGAGATTTCTCAAAGTCACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022135.2-1477s1c1
Sequence:CCGGCTGCAGAATCTTGGGCAAGTTCTCGAGAACTTGCCCAAGATTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022135.2-1265s1c1
Sequence:CCGGCTCTCTTCTGTGTTCACAGAACTCGAGTTCTGTGAACACAGAAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022135.2-1362s1c1
Sequence:CCGGCCAACACTGTCGCTACAGTAACTCGAGTTACTGTAGCGACAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022135.2-662s1c1
Sequence:CCGGCATCTTTCCATACCAGTTCATCTCGAGATGAACTGGTATGGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022135.2-659s1c1
Sequence:CCGGCTACATCTTTCCATACCAGTTCTCGAGAACTGGTATGGAAAGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022135
POPDC2 MISSION shRNA shRNA Plasmid DNA
popeye domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022135.2-1161s1c1
Sequence:CCGGCAGAGCTACTCTCAAGTTATACTCGAGTATAACTTGAGAGTAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022135.2-1386s1c1
Sequence:CCGGCCTGAAGTGACTTTGAGAAATCTCGAGATTTCTCAAAGTCACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022135.2-1477s1c1
Sequence:CCGGCTGCAGAATCTTGGGCAAGTTCTCGAGAACTTGCCCAAGATTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022135.2-1265s1c1
Sequence:CCGGCTCTCTTCTGTGTTCACAGAACTCGAGTTCTGTGAACACAGAAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022135.2-1362s1c1
Sequence:CCGGCCAACACTGTCGCTACAGTAACTCGAGTTACTGTAGCGACAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022135.2-662s1c1
Sequence:CCGGCATCTTTCCATACCAGTTCATCTCGAGATGAACTGGTATGGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022135.2-659s1c1
Sequence:CCGGCTACATCTTTCCATACCAGTTCTCGAGAACTGGTATGGAAAGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022135
POPDC2 MISSION shRNA Lentiviral Transduction Particles
popeye domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022135.2-1161s1c1
Sequence:CCGGCAGAGCTACTCTCAAGTTATACTCGAGTATAACTTGAGAGTAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022135.2-1386s1c1
Sequence:CCGGCCTGAAGTGACTTTGAGAAATCTCGAGATTTCTCAAAGTCACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022135.2-1477s1c1
Sequence:CCGGCTGCAGAATCTTGGGCAAGTTCTCGAGAACTTGCCCAAGATTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022135.2-1265s1c1
Sequence:CCGGCTCTCTTCTGTGTTCACAGAACTCGAGTTCTGTGAACACAGAAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022135.2-1362s1c1
Sequence:CCGGCCAACACTGTCGCTACAGTAACTCGAGTTACTGTAGCGACAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022135.2-662s1c1
Sequence:CCGGCATCTTTCCATACCAGTTCATCTCGAGATGAACTGGTATGGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022135.2-659s1c1
Sequence:CCGGCTACATCTTTCCATACCAGTTCTCGAGAACTGGTATGGAAAGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022318
POPDC2 MISSION shRNA Bacterial Glycerol Stock
popeye domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022318.1-1160s1c1
Sequence:CCGGGACAAGCTGTTTGCCAAGTTTCTCGAGAAACTTGGCAAACAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022318.1-934s1c1
Sequence:CCGGGCACTACATCTTTCCGTATCACTCGAGTGATACGGAAAGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022318.1-1455s1c1
Sequence:CCGGCTTCTCAAGTTATGTCCAGATCTCGAGATCTGGACATAACTTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022318.1-932s1c1
Sequence:CCGGCTGCACTACATCTTTCCGTATCTCGAGATACGGAAAGATGTAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022318.1-1633s1c1
Sequence:CCGGGATGGACATGACGTGAAGAAACTCGAGTTTCTTCACGTCATGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022318
POPDC2 MISSION shRNA shRNA Plasmid DNA
popeye domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022318.1-1160s1c1
Sequence:CCGGGACAAGCTGTTTGCCAAGTTTCTCGAGAAACTTGGCAAACAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022318.1-934s1c1
Sequence:CCGGGCACTACATCTTTCCGTATCACTCGAGTGATACGGAAAGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022318.1-1455s1c1
Sequence:CCGGCTTCTCAAGTTATGTCCAGATCTCGAGATCTGGACATAACTTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022318.1-932s1c1
Sequence:CCGGCTGCACTACATCTTTCCGTATCTCGAGATACGGAAAGATGTAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022318.1-1633s1c1
Sequence:CCGGGATGGACATGACGTGAAGAAACTCGAGTTTCTTCACGTCATGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022318
POPDC2 MISSION shRNA Lentiviral Transduction Particles
popeye domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022318.1-1160s1c1
Sequence:CCGGGACAAGCTGTTTGCCAAGTTTCTCGAGAAACTTGGCAAACAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022318.1-934s1c1
Sequence:CCGGGCACTACATCTTTCCGTATCACTCGAGTGATACGGAAAGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022318.1-1455s1c1
Sequence:CCGGCTTCTCAAGTTATGTCCAGATCTCGAGATCTGGACATAACTTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022318.1-932s1c1
Sequence:CCGGCTGCACTACATCTTTCCGTATCTCGAGATACGGAAAGATGTAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022318.1-1633s1c1
Sequence:CCGGGATGGACATGACGTGAAGAAACTCGAGTTTCTTCACGTCATGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks