EMAIL THIS PAGE TO A FRIEND

POTEC

POTE ankyrin domain family, member C

Synonyms: A26B2 CT104.6 POTE-18 POTE18
Species: Human POTEC(388468)
UniProtKB ID: B2RU33
Gene ID:
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001137671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001137671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001137671 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_496269 Rosetta Predictions human pricing
XM_932259 Rosetta Predictions human pricing
XM_932261 Rosetta Predictions human pricing
XM_932263 Rosetta Predictions human pricing
XM_932266 Rosetta Predictions human pricing
XM_932269 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295343 predicted 1127
2 SASI_Hs01_00295341 predicted 2171
3 SASI_Hs01_00295342 predicted 2162
4 SASI_Hs01_00295344 predicted 2043
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295505 predicted 1634
2 SASI_Hs01_00295506 predicted 1627
3 SASI_Hs01_00295507 predicted 687
4 SASI_Hs01_00295508 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266718 predicted 405
2 SASI_Hs01_00266719 predicted 591
3 SASI_Hs01_00266720 predicted 979
4 SASI_Hs01_00266721 predicted 977
5 SASI_Hs01_00266722 predicted 177
6 SASI_Hs01_00266723 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274897 predicted 590
2 SASI_Hs01_00274898 predicted 1634
3 SASI_Hs01_00274899 predicted 1625
4 SASI_Hs01_00274900 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277465 predicted 1919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264566 predicted 1113
2 SASI_Hs01_00264567 predicted 1584
3 SASI_Hs01_00264568 predicted 1549
4 SASI_Hs01_00264569 predicted 1559
5 SASI_Hs01_00264570 predicted 694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001137671
POTEC MISSION shRNA Bacterial Glycerol Stock
POTE ankyrin domain family, member C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1033s21c1
Sequence:CCGGGGACAGACGATGTCAACTTAACTCGAGTTAAGTTGACATCGTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1984s21c1
Sequence:CCGGTGAGCTTTCTCTTAGTCATAACTCGAGTTATGACTAAGAGAAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1924s21c1
Sequence:CCGGAGATGAGATTCTGACTAATAACTCGAGTTATTAGTCAGAATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1230s21c1
Sequence:CCGGTCTTATATGGTGCTGATATTGCTCGAGCAATATCAGCACCATATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1774s21c1
Sequence:CCGGCAATGGTGATGATGGATTAATCTCGAGATTAATCCATCATCACCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001137671
POTEC MISSION shRNA shRNA Plasmid DNA
POTE ankyrin domain family, member C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1033s21c1
Sequence:CCGGGGACAGACGATGTCAACTTAACTCGAGTTAAGTTGACATCGTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1984s21c1
Sequence:CCGGTGAGCTTTCTCTTAGTCATAACTCGAGTTATGACTAAGAGAAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1924s21c1
Sequence:CCGGAGATGAGATTCTGACTAATAACTCGAGTTATTAGTCAGAATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1230s21c1
Sequence:CCGGTCTTATATGGTGCTGATATTGCTCGAGCAATATCAGCACCATATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1774s21c1
Sequence:CCGGCAATGGTGATGATGGATTAATCTCGAGATTAATCCATCATCACCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001137671
POTEC MISSION shRNA Lentiviral Transduction Particles
POTE ankyrin domain family, member C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1033s21c1
Sequence:CCGGGGACAGACGATGTCAACTTAACTCGAGTTAAGTTGACATCGTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1984s21c1
Sequence:CCGGTGAGCTTTCTCTTAGTCATAACTCGAGTTATGACTAAGAGAAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1924s21c1
Sequence:CCGGAGATGAGATTCTGACTAATAACTCGAGTTATTAGTCAGAATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1230s21c1
Sequence:CCGGTCTTATATGGTGCTGATATTGCTCGAGCAATATCAGCACCATATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137671.1-1774s21c1
Sequence:CCGGCAATGGTGATGATGGATTAATCTCGAGATTAATCCATCATCACCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks