EMAIL THIS PAGE TO A FRIEND

POTED

POTE ankyrin domain family, member D

Synonyms: A26B3 ANKRD21 CT104.1 POTE POTE-21 POTE21
Species: Human POTED(317754)
UniProtKB ID: Q86YR6, C9JCF7
Gene ID:
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174981 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128321 MISSION® esiRNA esiRNA human ANKRD21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174981 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081354 predicted 1763
2 SASI_Hs01_00081355 predicted 1746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174981
POTED MISSION shRNA Bacterial Glycerol Stock
POTE ankyrin domain family, member D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-677s1c1
Sequence:CCGGGCTCTGATAAAGGCCATACAACTCGAGTTGTATGGCCTTTATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-1481s1c1
Sequence:CCGGCGGAAACAACTTTCTGAAGAACTCGAGTTCTTCAGAAAGTTGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-701s1c1
Sequence:CCGGCAGGAAGATGAATGTGTGTTACTCGAGTAACACACATTCATCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-824s1c1
Sequence:CCGGCTGCTCTTATATGGTGCTGATCTCGAGATCAGCACCATATAAGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-1371s1c1
Sequence:CCGGGCAATGGTGATGATGGATTAACTCGAGTTAATCCATCATCACCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-826s1c1
Sequence:CCGGGCTCTTATATGGTGCTGATATCTCGAGATATCAGCACCATATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-1170s1c1
Sequence:CCGGGCAATCCAGAACAAGACTTAACTCGAGTTAAGTCTTGTTCTGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-1074s1c1
Sequence:CCGGCCAGAGAGTATGCTGTTTCTACTCGAGTAGAAACAGCATACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-596s1c1
Sequence:CCGGGCCAATGGAAATTCAGAAGTACTCGAGTACTTCTGAATTTCCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-199s1c1
Sequence:CCGGCGACGACTCCTTTATGAAGATCTCGAGATCTTCATAAAGGAGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174981
POTED MISSION shRNA shRNA Plasmid DNA
POTE ankyrin domain family, member D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-677s1c1
Sequence:CCGGGCTCTGATAAAGGCCATACAACTCGAGTTGTATGGCCTTTATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-1481s1c1
Sequence:CCGGCGGAAACAACTTTCTGAAGAACTCGAGTTCTTCAGAAAGTTGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-701s1c1
Sequence:CCGGCAGGAAGATGAATGTGTGTTACTCGAGTAACACACATTCATCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-824s1c1
Sequence:CCGGCTGCTCTTATATGGTGCTGATCTCGAGATCAGCACCATATAAGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-1371s1c1
Sequence:CCGGGCAATGGTGATGATGGATTAACTCGAGTTAATCCATCATCACCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-826s1c1
Sequence:CCGGGCTCTTATATGGTGCTGATATCTCGAGATATCAGCACCATATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-1170s1c1
Sequence:CCGGGCAATCCAGAACAAGACTTAACTCGAGTTAAGTCTTGTTCTGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-1074s1c1
Sequence:CCGGCCAGAGAGTATGCTGTTTCTACTCGAGTAGAAACAGCATACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-596s1c1
Sequence:CCGGGCCAATGGAAATTCAGAAGTACTCGAGTACTTCTGAATTTCCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-199s1c1
Sequence:CCGGCGACGACTCCTTTATGAAGATCTCGAGATCTTCATAAAGGAGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174981
POTED MISSION shRNA Lentiviral Transduction Particles
POTE ankyrin domain family, member D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-677s1c1
Sequence:CCGGGCTCTGATAAAGGCCATACAACTCGAGTTGTATGGCCTTTATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-1481s1c1
Sequence:CCGGCGGAAACAACTTTCTGAAGAACTCGAGTTCTTCAGAAAGTTGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-701s1c1
Sequence:CCGGCAGGAAGATGAATGTGTGTTACTCGAGTAACACACATTCATCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-824s1c1
Sequence:CCGGCTGCTCTTATATGGTGCTGATCTCGAGATCAGCACCATATAAGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-1371s1c1
Sequence:CCGGGCAATGGTGATGATGGATTAACTCGAGTTAATCCATCATCACCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-826s1c1
Sequence:CCGGGCTCTTATATGGTGCTGATATCTCGAGATATCAGCACCATATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-1170s1c1
Sequence:CCGGGCAATCCAGAACAAGACTTAACTCGAGTTAAGTCTTGTTCTGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-1074s1c1
Sequence:CCGGCCAGAGAGTATGCTGTTTCTACTCGAGTAGAAACAGCATACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174981.2-596s1c1
Sequence:CCGGGCCAATGGAAATTCAGAAGTACTCGAGTACTTCTGAATTTCCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174981.2-199s1c1
Sequence:CCGGCGACGACTCCTTTATGAAGATCTCGAGATCTTCATAAAGGAGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks