EMAIL THIS PAGE TO A FRIEND

POTEG

POTE ankyrin domain family, member G

Synonyms: A26C2 ACTBL1 CT104.4 POTE-14 POTE14 POTE14alpha POTE22
UniProtKB ID: Q6S5H5, A1L153, A6NMI9, Q6S5H6, Q6S8J2
Gene ID:
Mouse(70952) POTE ankyrin domain family, member G
Rat(364620) POTE ankyrin domain family, member G
178 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207513 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005356 Rosetta Predictions human pricing
NM_001005357 Rosetta Predictions human pricing
NM_207513 Rosetta Predictions human pricing
NM_001014238 Rosetta Predictions rat pricing
NM_026256 Rosetta Predictions mouse pricing
NM_027618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024022 predicted 1322
2 SASI_Hs01_00024023 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241516 predicted 1323
2 SASI_Hs01_00241517 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198197 predicted 1582
2 SASI_Hs01_00198198 predicted 1580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066014 predicted 228
2 SASI_Rn01_00066015 predicted 762
3 SASI_Rn01_00066016 predicted 823
4 SASI_Rn01_00066017 predicted 221
5 SASI_Rn01_00066018 predicted 776
6 SASI_Rn01_00066019 predicted 460
7 SASI_Rn01_00066020 predicted 604
8 SASI_Rn01_00066021 predicted 382
9 SASI_Rn01_00066022 predicted 222
10 SASI_Rn01_00066023 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329941 predicted 649
2 SASI_Mm02_00329942 predicted 830
3 SASI_Mm01_00136265 predicted 848
4 SASI_Mm01_00136266 predicted 903
5 SASI_Mm01_00136267 predicted 802
6 SASI_Mm01_00136268 predicted 780
7 SASI_Mm02_00329943 predicted 507
8 SASI_Mm01_00136272 predicted 498
9 SASI_Mm01_00136273 predicted 487
10 SASI_Mm02_00329944 predicted 758
11 SASI_Mm01_00136269 predicted 251
12 SASI_Mm01_00136270 predicted 813
13 SASI_Mm01_00136271 predicted 792
14 SASI_Mm01_00136274 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332458 predicted 646
2 SASI_Mm02_00332459 predicted 831
3 SASI_Mm02_00332460 predicted 851
4 SASI_Mm02_00332461 predicted 903
5 SASI_Mm02_00332462 predicted 801
6 SASI_Mm02_00332463 predicted 780
7 SASI_Mm02_00332464 predicted 504
8 SASI_Mm02_00332465 predicted 495
9 SASI_Mm02_00332466 predicted 479
10 SASI_Mm02_00332467 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207513
POTEG MISSION shRNA Bacterial Glycerol Stock
POTE ankyrin domain family, member G
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207513.1-1502s1c1
Sequence:CCGGCCAGAGGAAATGTCTCAAGAACTCGAGTTCTTGAGACATTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-1372s1c1
Sequence:CCGGCCAGTTACTTTCTGACTACAACTCGAGTTGTAGTCAGAAAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207513.1-1754s1c1
Sequence:CCGGGAAGAACAGAACACTGGAATACTCGAGTATTCCAGTGTTCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-716s1c1
Sequence:CCGGGCGTTAATGTTGCTGGAACATCTCGAGATGTTCCAGCAACATTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207513.1-1428s1c1
Sequence:CCGGGCAATCCAGAACAAGACTCAACTCGAGTTGAGTCTTGTTCTGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-835s1c1
Sequence:CCGGCGGTGCTGATATCGAATCAAACTCGAGTTTGATTCGATATCAGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-1332s1c1
Sequence:CCGGCCAGAGAGTATGCTGTTTCTACTCGAGTAGAAACAGCATACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-196s1c1
Sequence:CCGGCCACGACGATTCTGCTATGAACTCGAGTTCATAGCAGAATCGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207513
POTEG MISSION shRNA shRNA Plasmid DNA
POTE ankyrin domain family, member G
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207513.1-1502s1c1
Sequence:CCGGCCAGAGGAAATGTCTCAAGAACTCGAGTTCTTGAGACATTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-1372s1c1
Sequence:CCGGCCAGTTACTTTCTGACTACAACTCGAGTTGTAGTCAGAAAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207513.1-1754s1c1
Sequence:CCGGGAAGAACAGAACACTGGAATACTCGAGTATTCCAGTGTTCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-716s1c1
Sequence:CCGGGCGTTAATGTTGCTGGAACATCTCGAGATGTTCCAGCAACATTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207513.1-1428s1c1
Sequence:CCGGGCAATCCAGAACAAGACTCAACTCGAGTTGAGTCTTGTTCTGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-835s1c1
Sequence:CCGGCGGTGCTGATATCGAATCAAACTCGAGTTTGATTCGATATCAGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-1332s1c1
Sequence:CCGGCCAGAGAGTATGCTGTTTCTACTCGAGTAGAAACAGCATACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-196s1c1
Sequence:CCGGCCACGACGATTCTGCTATGAACTCGAGTTCATAGCAGAATCGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207513
POTEG MISSION shRNA Lentiviral Transduction Particles
POTE ankyrin domain family, member G
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207513.1-1502s1c1
Sequence:CCGGCCAGAGGAAATGTCTCAAGAACTCGAGTTCTTGAGACATTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-1372s1c1
Sequence:CCGGCCAGTTACTTTCTGACTACAACTCGAGTTGTAGTCAGAAAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207513.1-1754s1c1
Sequence:CCGGGAAGAACAGAACACTGGAATACTCGAGTATTCCAGTGTTCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-716s1c1
Sequence:CCGGGCGTTAATGTTGCTGGAACATCTCGAGATGTTCCAGCAACATTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207513.1-1428s1c1
Sequence:CCGGGCAATCCAGAACAAGACTCAACTCGAGTTGAGTCTTGTTCTGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-835s1c1
Sequence:CCGGCGGTGCTGATATCGAATCAAACTCGAGTTTGATTCGATATCAGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-1332s1c1
Sequence:CCGGCCAGAGAGTATGCTGTTTCTACTCGAGTAGAAACAGCATACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207513.1-196s1c1
Sequence:CCGGCCACGACGATTCTGCTATGAACTCGAGTTCATAGCAGAATCGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026256
POTEG MISSION shRNA Bacterial Glycerol Stock
POTE ankyrin domain family, member G
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026256.1-1279s1c1
Sequence:CCGGCAATTTGGTAAGCAATCAGAACTCGAGTTCTGATTGCTTACCAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026256.1-272s1c1
Sequence:CCGGCCATACAACATACAGACCGTTCTCGAGAACGGTCTGTATGTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026256.1-793s1c1
Sequence:CCGGACACCTTGATATACGCTATAACTCGAGTTATAGCGTATATCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026256.1-806s1c1
Sequence:CCGGCGCTATAAGATGTGGATCAAACTCGAGTTTGATCCACATCTTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026256.1-647s1c1
Sequence:CCGGGCTTCAGTACAACGCTGATATCTCGAGATATCAGCGTTGTACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026256
POTEG MISSION shRNA shRNA Plasmid DNA
POTE ankyrin domain family, member G
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026256.1-1279s1c1
Sequence:CCGGCAATTTGGTAAGCAATCAGAACTCGAGTTCTGATTGCTTACCAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026256.1-272s1c1
Sequence:CCGGCCATACAACATACAGACCGTTCTCGAGAACGGTCTGTATGTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026256.1-793s1c1
Sequence:CCGGACACCTTGATATACGCTATAACTCGAGTTATAGCGTATATCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026256.1-806s1c1
Sequence:CCGGCGCTATAAGATGTGGATCAAACTCGAGTTTGATCCACATCTTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026256.1-647s1c1
Sequence:CCGGGCTTCAGTACAACGCTGATATCTCGAGATATCAGCGTTGTACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026256
POTEG MISSION shRNA Lentiviral Transduction Particles
POTE ankyrin domain family, member G
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026256.1-1279s1c1
Sequence:CCGGCAATTTGGTAAGCAATCAGAACTCGAGTTCTGATTGCTTACCAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026256.1-272s1c1
Sequence:CCGGCCATACAACATACAGACCGTTCTCGAGAACGGTCTGTATGTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026256.1-793s1c1
Sequence:CCGGACACCTTGATATACGCTATAACTCGAGTTATAGCGTATATCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026256.1-806s1c1
Sequence:CCGGCGCTATAAGATGTGGATCAAACTCGAGTTTGATCCACATCTTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026256.1-647s1c1
Sequence:CCGGGCTTCAGTACAACGCTGATATCTCGAGATATCAGCGTTGTACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks