EMAIL THIS PAGE TO A FRIEND

POU3F4

POU class 3 homeobox 4

Synonyms: BRAIN-4 BRN-4 BRN4 DFN3 DFNX2 OCT-9 OTF-9 OTF9
UniProtKB ID: P49335, B2RC71, Q5H9G9, Q99410
Gene ID:
Human(5456) Summary: This gene encodes a member of the POU-III class of neural transcription factors. This family member plays a role in inner ear development. The protein is thought to be involved in the mediation of epigenetic signals which induce striatal neuron-precursor differentiation. Mutations in this gene are associated with X chromosome-linked nonsyndromic mixed deafness. [provided by RefSeq, Dec 2012]
Mouse(18994) POU domain, class 3, transcription factor 4
Rat(29589) POU class 3 homeobox 4
chicken(100857422) POU class 3 homeobox 4
Horse(100071720) POU class 3 homeobox 4
dog(491988) POU class 3 homeobox 4
domestic guinea pig(100721430) POU class 3 homeobox 4
naked mole-rat(101704095) POU class 3 homeobox 4
cow(539732) POU class 3 homeobox 4
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV100907 Anti-POU3F4 antibody produced in rabbit IgG fraction of antiserum mouse, pig, bovine, human, canine, horse
western blot pricing
HPA031984 Anti-POU3F4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008901 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008901 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008901 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000307 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000307 Rosetta Predictions human pricing
NM_017252 Rosetta Predictions rat pricing
NM_008901 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244075 predicted 702
2 SASI_Hs02_00302299 predicted 207
3 SASI_Hs01_00244076 predicted 631
4 SASI_Hs01_00244077 predicted 907
5 SASI_Hs01_00244079 predicted 628
6 SASI_Hs01_00244080 predicted 560
7 SASI_Hs02_00302300 predicted 622
8 SASI_Hs01_00244081 predicted 619
9 SASI_Hs01_00244082 predicted 457
10 SASI_Hs01_00244083 predicted 616
11 SASI_Hs01_00244078 predicted 596
12 SASI_Hs01_00244084 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120849 predicted 999
2 SASI_Rn01_00120851 predicted 766
3 SASI_Rn01_00120852 predicted 441
4 SASI_Rn01_00120853 predicted 438
5 SASI_Rn02_00261641 predicted 600
6 SASI_Rn01_00120854 predicted 723
7 SASI_Rn01_00120855 predicted 769
8 SASI_Rn01_00120856 predicted 729
9 SASI_Rn01_00120857 predicted 642
10 SASI_Rn01_00120858 predicted 417
11 SASI_Rn01_00120850 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127939 predicted 728
2 SASI_Mm01_00127940 predicted 587
3 SASI_Mm01_00127941 predicted 854
4 SASI_Mm01_00127942 predicted 702
5 SASI_Mm01_00127943 predicted 733
6 SASI_Mm01_00127944 predicted 858
7 SASI_Mm01_00127945 predicted 351
8 SASI_Mm01_00127946 predicted 699
9 SASI_Mm01_00127947 predicted 816
10 SASI_Mm01_00127948 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008901
POU3F4 MISSION shRNA Bacterial Glycerol Stock
POU class 3 homeobox 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008901.1-822s21c1
Sequence:CCGGTCAAGGCCGCAAACGCAAGAACTCGAGTTCTTGCGTTTGCGGCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008901.1-261s21c1
Sequence:CCGGTCTGCAACTGGGCGCAATCATCTCGAGATGATTGCGCCCAGTTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008901.1-589s21c1
Sequence:CCGGTTCGCCAAACAATTCAAACAACTCGAGTTGTTTGAATTGTTTGGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-738s1c1
Sequence:CCGGCAAGCTGAAACCGCTATTAAACTCGAGTTTAATAGCGGTTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-88s1c1
Sequence:CCGGCCTTTCCGCAATCCTCAGAAACTCGAGTTTCTGAGGATTGCGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-315s1c1
Sequence:CCGGGCCGCACACTAACCATCCGAACTCGAGTTCGGATGGTTAGTGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-869s1c1
Sequence:CCGGAGGGCGTACTGGAAACACATTCTCGAGAATGTGTTTCCAGTACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-737s1c1
Sequence:CCGGGCAAGCTGAAACCGCTATTAACTCGAGTTAATAGCGGTTTCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008901
POU3F4 MISSION shRNA shRNA Plasmid DNA
POU class 3 homeobox 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008901.1-822s21c1
Sequence:CCGGTCAAGGCCGCAAACGCAAGAACTCGAGTTCTTGCGTTTGCGGCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008901.1-261s21c1
Sequence:CCGGTCTGCAACTGGGCGCAATCATCTCGAGATGATTGCGCCCAGTTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008901.1-589s21c1
Sequence:CCGGTTCGCCAAACAATTCAAACAACTCGAGTTGTTTGAATTGTTTGGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-738s1c1
Sequence:CCGGCAAGCTGAAACCGCTATTAAACTCGAGTTTAATAGCGGTTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-88s1c1
Sequence:CCGGCCTTTCCGCAATCCTCAGAAACTCGAGTTTCTGAGGATTGCGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-315s1c1
Sequence:CCGGGCCGCACACTAACCATCCGAACTCGAGTTCGGATGGTTAGTGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-869s1c1
Sequence:CCGGAGGGCGTACTGGAAACACATTCTCGAGAATGTGTTTCCAGTACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-737s1c1
Sequence:CCGGGCAAGCTGAAACCGCTATTAACTCGAGTTAATAGCGGTTTCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008901
POU3F4 MISSION shRNA Lentiviral Transduction Particles
POU class 3 homeobox 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008901.1-822s21c1
Sequence:CCGGTCAAGGCCGCAAACGCAAGAACTCGAGTTCTTGCGTTTGCGGCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008901.1-261s21c1
Sequence:CCGGTCTGCAACTGGGCGCAATCATCTCGAGATGATTGCGCCCAGTTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008901.1-589s21c1
Sequence:CCGGTTCGCCAAACAATTCAAACAACTCGAGTTGTTTGAATTGTTTGGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-738s1c1
Sequence:CCGGCAAGCTGAAACCGCTATTAAACTCGAGTTTAATAGCGGTTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-88s1c1
Sequence:CCGGCCTTTCCGCAATCCTCAGAAACTCGAGTTTCTGAGGATTGCGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-315s1c1
Sequence:CCGGGCCGCACACTAACCATCCGAACTCGAGTTCGGATGGTTAGTGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-869s1c1
Sequence:CCGGAGGGCGTACTGGAAACACATTCTCGAGAATGTGTTTCCAGTACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008901.1-737s1c1
Sequence:CCGGGCAAGCTGAAACCGCTATTAACTCGAGTTAATAGCGGTTTCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000307
POU3F4 MISSION shRNA Bacterial Glycerol Stock
POU class 3 homeobox 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000307.3-1268s21c1
Sequence:CCGGTCGCTCTCTCGTACTCTCTCTCTCGAGAGAGAGAGTACGAGAGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000307.3-371s21c1
Sequence:CCGGCACCACTCACCGCACACTAACCTCGAGGTTAGTGTGCGGTGAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000307.1-1316s1c1
Sequence:CCGGCCCTTTCCTTTCCTTTCATTTCTCGAGAAATGAAAGGAAAGGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000307.1-917s1c1
Sequence:CCGGGCATTTCCTCAAGTGTCCCAACTCGAGTTGGGACACTTGAGGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000307.1-130s1c1
Sequence:CCGGACCCTCAGAAACTTCTCCAAACTCGAGTTTGGAGAAGTTTCTGAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000307.1-1005s1c1
Sequence:CCGGTGGTTCTGTAATCGAAGACAACTCGAGTTGTCTTCGATTACAGAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000307.1-597s1c1
Sequence:CCGGCCAACCTCTGATGAGTTGGAACTCGAGTTCCAACTCATCAGAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000307
POU3F4 MISSION shRNA shRNA Plasmid DNA
POU class 3 homeobox 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000307.3-1268s21c1
Sequence:CCGGTCGCTCTCTCGTACTCTCTCTCTCGAGAGAGAGAGTACGAGAGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000307.3-371s21c1
Sequence:CCGGCACCACTCACCGCACACTAACCTCGAGGTTAGTGTGCGGTGAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000307.1-1316s1c1
Sequence:CCGGCCCTTTCCTTTCCTTTCATTTCTCGAGAAATGAAAGGAAAGGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000307.1-917s1c1
Sequence:CCGGGCATTTCCTCAAGTGTCCCAACTCGAGTTGGGACACTTGAGGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000307.1-130s1c1
Sequence:CCGGACCCTCAGAAACTTCTCCAAACTCGAGTTTGGAGAAGTTTCTGAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000307.1-1005s1c1
Sequence:CCGGTGGTTCTGTAATCGAAGACAACTCGAGTTGTCTTCGATTACAGAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000307.1-597s1c1
Sequence:CCGGCCAACCTCTGATGAGTTGGAACTCGAGTTCCAACTCATCAGAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000307
POU3F4 MISSION shRNA Lentiviral Transduction Particles
POU class 3 homeobox 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000307.3-1268s21c1
Sequence:CCGGTCGCTCTCTCGTACTCTCTCTCTCGAGAGAGAGAGTACGAGAGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000307.3-371s21c1
Sequence:CCGGCACCACTCACCGCACACTAACCTCGAGGTTAGTGTGCGGTGAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000307.1-1316s1c1
Sequence:CCGGCCCTTTCCTTTCCTTTCATTTCTCGAGAAATGAAAGGAAAGGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000307.1-917s1c1
Sequence:CCGGGCATTTCCTCAAGTGTCCCAACTCGAGTTGGGACACTTGAGGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000307.1-130s1c1
Sequence:CCGGACCCTCAGAAACTTCTCCAAACTCGAGTTTGGAGAAGTTTCTGAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000307.1-1005s1c1
Sequence:CCGGTGGTTCTGTAATCGAAGACAACTCGAGTTGTCTTCGATTACAGAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000307.1-597s1c1
Sequence:CCGGCCAACCTCTGATGAGTTGGAACTCGAGTTCCAACTCATCAGAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks