EMAIL THIS PAGE TO A FRIEND

PPAN

peter pan homolog (Drosophila)

Synonyms: BXDC3 SSF SSF-1 SSF1 SSF2
UniProtKB ID: Q9NQ55, C9J3F9, Q9BW97, Q9H170
Gene ID:
Human(56342) Summary: The protein encoded by this gene is an evolutionarily conserved protein similar to yeast SSF1 as well as to the gene product of the Drosophila gene peter pan (ppan). SSF1 is known to be involved in the second step of mRNA splicing. Both SSF1 and ppan are essential for cell growth and proliferation. Exogenous expression of this gene was reported to reduce the anchorage-independent growth of some tumor cells. Read-through transcription of this gene with P2RY11/P2Y(11), an adjacent downstream gene that encodes an ATP receptor, has been found. These read-through transcripts are ubiquitously present and up-regulated during granulocyte differentiation. [provided by RefSeq, Nov 2010]
Mouse(235036) peter pan homolog (Drosophila)
Rat(298699) peter pan homolog (Drosophila)
fruit fly(42502) peter pan
Thale Cress(836299) Peter Pan-like protein
Zebrafish(317739) peter pan homolog (Drosophila)
dog(100533478) peter pan homolog (Drosophila)
naked mole-rat(101712006) peter pan homolog (Drosophila)
cow(522370) peter pan homolog (Drosophila)
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043265 Anti-PPAN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020230 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020230 Rosetta Predictions human pricing
NM_001011980 Rosetta Predictions rat pricing
XM_576368 Rosetta Predictions rat pricing
NM_145610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229798 predicted 671
2 SASI_Hs01_00229799 predicted 922
3 SASI_Hs01_00229800 predicted 689
4 SASI_Hs01_00229801 predicted 975
5 SASI_Hs01_00229802 predicted 683
6 SASI_Hs01_00229803 predicted 693
7 SASI_Hs01_00229804 predicted 1085
8 SASI_Hs01_00229805 predicted 680
9 SASI_Hs01_00229806 predicted 690
10 SASI_Hs01_00229807 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037106 predicted 496
2 SASI_Rn01_00037107 predicted 359
3 SASI_Rn02_00200005 predicted 1231
4 SASI_Rn01_00037109 predicted 663
5 SASI_Rn01_00037110 predicted 1074
6 SASI_Rn01_00037111 predicted 431
7 SASI_Rn01_00037112 predicted 1345
8 SASI_Rn01_00037113 predicted 1043
9 SASI_Rn01_00037114 predicted 535
10 SASI_Rn02_00200006 predicted 581
11 SASI_Rn01_00037108 predicted 471
12 SASI_Rn01_00037115 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156148 predicted 440
2 SASI_Rn01_00156149 predicted 298
3 SASI_Rn01_00156150 predicted 408
4 SASI_Rn01_00156151 predicted 377
5 SASI_Rn01_00156152 predicted 1178
6 SASI_Rn01_00156153 predicted 469
7 SASI_Rn01_00156154 predicted 492
8 SASI_Rn01_00156155 predicted 374
9 SASI_Rn01_00156156 predicted 981
10 SASI_Rn01_00156157 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158860 predicted 916
2 SASI_Mm01_00158861 predicted 594
3 SASI_Mm01_00158862 predicted 388
4 SASI_Mm01_00158863 predicted 1339
5 SASI_Mm01_00158864 predicted 660
6 SASI_Mm01_00158865 predicted 1104
7 SASI_Mm01_00158866 predicted 616
8 SASI_Mm01_00158868 predicted 1284
9 SASI_Mm01_00158869 predicted 703
10 SASI_Mm02_00341177 predicted 320
11 SASI_Mm01_00158867 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020230
VALIDATED
PPAN MISSION shRNA Bacterial Glycerol Stock
peter pan homolog (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020230.3-985s1c1
Sequence:CCGGCAAAGTGATGTTCCACAGTTTCTCGAGAAACTGTGGAACATCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020230.3-1234s1c1
Sequence:CCGGGAGGACGATGATGAACAGGAACTCGAGTTCCTGTTCATCATCGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_020230.3-940s1c1
Sequence:CCGGGATGACACTGCAGCTCATCAACTCGAGTTGATGAGCTGCAGTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020230.3-616s1c1
Sequence:CCGGCAAGGTGAACCTGAACACCATCTCGAGATGGTGTTCAGGTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_020230.3-1252s1c1
Sequence:CCGGGAAGATGATGACATCGAGTATCTCGAGATACTCGATGTCATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020230.4-298s21c1
Sequence:CCGGTCGTAAGAAGAACTCGCTGAACTCGAGTTCAGCGAGTTCTTCTTACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020230.4-678s21c1
Sequence:CCGGAGCTGGACTTCCGCCACTATACTCGAGTATAGTGGCGGAAGTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020230.4-1392s21c1
Sequence:CCGGGTCGCCTTTGTGACCAGAAGTCTCGAGACTTCTGGTCACAAAGGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020230
VALIDATED
PPAN MISSION shRNA shRNA Plasmid DNA
peter pan homolog (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020230.3-985s1c1
Sequence:CCGGCAAAGTGATGTTCCACAGTTTCTCGAGAAACTGTGGAACATCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020230.3-1234s1c1
Sequence:CCGGGAGGACGATGATGAACAGGAACTCGAGTTCCTGTTCATCATCGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_020230.3-940s1c1
Sequence:CCGGGATGACACTGCAGCTCATCAACTCGAGTTGATGAGCTGCAGTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020230.3-616s1c1
Sequence:CCGGCAAGGTGAACCTGAACACCATCTCGAGATGGTGTTCAGGTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_020230.3-1252s1c1
Sequence:CCGGGAAGATGATGACATCGAGTATCTCGAGATACTCGATGTCATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020230.4-298s21c1
Sequence:CCGGTCGTAAGAAGAACTCGCTGAACTCGAGTTCAGCGAGTTCTTCTTACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020230.4-678s21c1
Sequence:CCGGAGCTGGACTTCCGCCACTATACTCGAGTATAGTGGCGGAAGTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020230.4-1392s21c1
Sequence:CCGGGTCGCCTTTGTGACCAGAAGTCTCGAGACTTCTGGTCACAAAGGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020230
VALIDATED
PPAN MISSION shRNA Lentiviral Transduction Particles
peter pan homolog (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020230.3-985s1c1
Sequence:CCGGCAAAGTGATGTTCCACAGTTTCTCGAGAAACTGTGGAACATCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020230.3-1234s1c1
Sequence:CCGGGAGGACGATGATGAACAGGAACTCGAGTTCCTGTTCATCATCGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_020230.3-940s1c1
Sequence:CCGGGATGACACTGCAGCTCATCAACTCGAGTTGATGAGCTGCAGTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020230.3-616s1c1
Sequence:CCGGCAAGGTGAACCTGAACACCATCTCGAGATGGTGTTCAGGTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_020230.3-1252s1c1
Sequence:CCGGGAAGATGATGACATCGAGTATCTCGAGATACTCGATGTCATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020230.4-298s21c1
Sequence:CCGGTCGTAAGAAGAACTCGCTGAACTCGAGTTCAGCGAGTTCTTCTTACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020230.4-678s21c1
Sequence:CCGGAGCTGGACTTCCGCCACTATACTCGAGTATAGTGGCGGAAGTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020230.4-1392s21c1
Sequence:CCGGGTCGCCTTTGTGACCAGAAGTCTCGAGACTTCTGGTCACAAAGGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145610
PPAN MISSION shRNA Bacterial Glycerol Stock
peter pan homolog (Drosophila)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145610.1-586s1c1
Sequence:CCGGCCTCATTAACTACAACCCTGACTCGAGTCAGGGTTGTAGTTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145610.1-369s1c1
Sequence:CCGGCGTTCCAGATCAGCAAGTATACTCGAGTATACTTGCTGATCTGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145610.1-1459s1c1
Sequence:CCGGCTGCCGGCAGTGGGTGGACTACTCGAGTAGTCCACCCACTGCCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145610.1-1432s1c1
Sequence:CCGGCCCAGCATCAAGGAGAAGAAACTCGAGTTTCTTCTCCTTGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145610.1-886s1c1
Sequence:CCGGGCAGCTCATTAAGATCCAGGACTCGAGTCCTGGATCTTAATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-1189s21c1
Sequence:CCGGAGAGGATGACGCTGAGTATTTCTCGAGAAATACTCAGCGTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-431s21c1
Sequence:CCGGATGCACGAGCAGCAGTTTAACCTCGAGGTTAAACTGCTGCTCGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-557s21c1
Sequence:CCGGGTGAACCTGAACACCATTAAGCTCGAGCTTAATGGTGTTCAGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-624s21c1
Sequence:CCGGTCCGACACTACAGCGTCAAAGCTCGAGCTTTGACGCTGTAGTGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-1309s21c1
Sequence:CCGGGGAGCAGAGGCCTGGTAATAACTCGAGTTATTACCAGGCCTCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.2-1392s21c1
Sequence:CCGGGAGCAGAGGCCTGGTAATAAACTCGAGTTTATTACCAGGCCTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.2-656s21c1
Sequence:CCGGTAAGCGCTGCCTCCTCATTAACTCGAGTTAATGAGGAGGCAGCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.2-452s21c1
Sequence:CCGGGTTCCAGATCAGCAAGTATACCTCGAGGTATACTTGCTGATCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145610
PPAN MISSION shRNA shRNA Plasmid DNA
peter pan homolog (Drosophila)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145610.1-586s1c1
Sequence:CCGGCCTCATTAACTACAACCCTGACTCGAGTCAGGGTTGTAGTTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145610.1-369s1c1
Sequence:CCGGCGTTCCAGATCAGCAAGTATACTCGAGTATACTTGCTGATCTGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145610.1-1459s1c1
Sequence:CCGGCTGCCGGCAGTGGGTGGACTACTCGAGTAGTCCACCCACTGCCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145610.1-1432s1c1
Sequence:CCGGCCCAGCATCAAGGAGAAGAAACTCGAGTTTCTTCTCCTTGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145610.1-886s1c1
Sequence:CCGGGCAGCTCATTAAGATCCAGGACTCGAGTCCTGGATCTTAATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-1189s21c1
Sequence:CCGGAGAGGATGACGCTGAGTATTTCTCGAGAAATACTCAGCGTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-431s21c1
Sequence:CCGGATGCACGAGCAGCAGTTTAACCTCGAGGTTAAACTGCTGCTCGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-557s21c1
Sequence:CCGGGTGAACCTGAACACCATTAAGCTCGAGCTTAATGGTGTTCAGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-624s21c1
Sequence:CCGGTCCGACACTACAGCGTCAAAGCTCGAGCTTTGACGCTGTAGTGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-1309s21c1
Sequence:CCGGGGAGCAGAGGCCTGGTAATAACTCGAGTTATTACCAGGCCTCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.2-1392s21c1
Sequence:CCGGGAGCAGAGGCCTGGTAATAAACTCGAGTTTATTACCAGGCCTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.2-656s21c1
Sequence:CCGGTAAGCGCTGCCTCCTCATTAACTCGAGTTAATGAGGAGGCAGCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.2-452s21c1
Sequence:CCGGGTTCCAGATCAGCAAGTATACCTCGAGGTATACTTGCTGATCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145610
PPAN MISSION shRNA Lentiviral Transduction Particles
peter pan homolog (Drosophila)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145610.1-586s1c1
Sequence:CCGGCCTCATTAACTACAACCCTGACTCGAGTCAGGGTTGTAGTTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145610.1-369s1c1
Sequence:CCGGCGTTCCAGATCAGCAAGTATACTCGAGTATACTTGCTGATCTGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145610.1-1459s1c1
Sequence:CCGGCTGCCGGCAGTGGGTGGACTACTCGAGTAGTCCACCCACTGCCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145610.1-1432s1c1
Sequence:CCGGCCCAGCATCAAGGAGAAGAAACTCGAGTTTCTTCTCCTTGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145610.1-886s1c1
Sequence:CCGGGCAGCTCATTAAGATCCAGGACTCGAGTCCTGGATCTTAATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-1189s21c1
Sequence:CCGGAGAGGATGACGCTGAGTATTTCTCGAGAAATACTCAGCGTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-431s21c1
Sequence:CCGGATGCACGAGCAGCAGTTTAACCTCGAGGTTAAACTGCTGCTCGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-557s21c1
Sequence:CCGGGTGAACCTGAACACCATTAAGCTCGAGCTTAATGGTGTTCAGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-624s21c1
Sequence:CCGGTCCGACACTACAGCGTCAAAGCTCGAGCTTTGACGCTGTAGTGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.1-1309s21c1
Sequence:CCGGGGAGCAGAGGCCTGGTAATAACTCGAGTTATTACCAGGCCTCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.2-1392s21c1
Sequence:CCGGGAGCAGAGGCCTGGTAATAAACTCGAGTTTATTACCAGGCCTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.2-656s21c1
Sequence:CCGGTAAGCGCTGCCTCCTCATTAACTCGAGTTAATGAGGAGGCAGCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145610.2-452s21c1
Sequence:CCGGGTTCCAGATCAGCAAGTATACCTCGAGGTATACTTGCTGATCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks